Limits...
Two novel families of plasmids from hyperthermophilic archaea encoding new families of replication proteins.

Soler N, Marguet E, Cortez D, Desnoues N, Keller J, van Tilbeurgh H, Sezonov G, Forterre P - Nucleic Acids Res. (2010)

Bottom Line: The plasmid pT26-2 from Thermococcus sp. 26-2 (21.5 kb), that corresponds to another plasmid family, encodes many proteins having homologues in virus-like elements integrated in several genomes of Thermococcales and Methanococcales.Whereas all plasmids previously isolated from Thermococcales replicate by the rolling circle mechanism, the three plasmids described here probably replicate by the theta mechanism.The plasmids pTN2 and pP12-1 encode a putative helicase of the SFI superfamily and a new family of DNA polymerase, whose activity was demonstrated in vitro, whereas pT26-2 encodes a putative new type of helicase.

View Article: PubMed Central - PubMed

Affiliation: Institut de Génétique et Microbiologie, Univ Paris-Sud, Orsay, France. nicolas.soler@inserm.fr

ABSTRACT
Thermococcales (phylum Euryarchaeota) are model organisms for physiological and molecular studies of hyperthermophiles. Here we describe three new plasmids from Thermococcales that could provide new tools and model systems for genetic and molecular studies in Archaea. The plasmids pTN2 from Thermococcus nautilus sp. 30-1 and pP12-1 from Pyrococcus sp. 12-1 belong to the same family. They have similar size (approximately 12 kb) and share six genes, including homologues of genes encoded by the virus PAV1 from Pyrococcus abyssi. The plasmid pT26-2 from Thermococcus sp. 26-2 (21.5 kb), that corresponds to another plasmid family, encodes many proteins having homologues in virus-like elements integrated in several genomes of Thermococcales and Methanococcales. Our analyses confirm that viruses and plasmids are evolutionary related and co-evolve with their hosts. Whereas all plasmids previously isolated from Thermococcales replicate by the rolling circle mechanism, the three plasmids described here probably replicate by the theta mechanism. The plasmids pTN2 and pP12-1 encode a putative helicase of the SFI superfamily and a new family of DNA polymerase, whose activity was demonstrated in vitro, whereas pT26-2 encodes a putative new type of helicase. This strengthens the idea that plasmids and viruses are a reservoir of novel protein families involved in DNA replication.

Show MeSH

Related in: MedlinePlus

tn2-12p is a DNA polymerase. (A) Lanes 1–4: 5′-32P oligonucleotides of 40, 42, 43 and 45 mers. Lane 5: 5′-32P labelled 20 nt oligonucleotide CGAACCCGTTCTCGGAGCAC, no protein added. The recombinant protein tn2-12p (2.5 and 5 μM, lanes 6 and 7, respectively) or Taq polymerase (Promega, 0.04 U/μl, lane 8) were incubated with this short primer-template substrate hybridized to 42-nt template TTCTGCACAAAGCGGTTCTGCAGTGCTCCGAGAACGGGTTCG. Primers are extended in the presence of 0.2 mM dNTPs during 20 min at 70°C. The buffer used for the polymerization reaction is described in ‘Materials and Methods’ section. Extension products were analysed on the 16% denaturating polyacrylamide gel. Magnification: two very close bands of 42 and 43 bp are clearly visible. (B) The recombinant protein tn2-12p (15 μM, lanes 1 and 2) or Taq polymerase (Promega, 0.02 U/μl, lane 3) were incubated with a short primer-template substrate (5′-32P labelled 20 nt oligonucleotide CGAACCCGTTCTCGGAGCAC hybridized to 42 nt template TTCTGCACAAAGCGGTTCTGCAGTGCTCCGAGAACGGGTTCG). Primers are extended in the presence of 0.2 mM dNTPs (lanes 1 and 3) or 0.2 mM NTPs (lane 2) during 20 min at 70°C. In the control reaction with NTPs (lane 2) no primer elongation was observed. The buffer used for the polymerization reaction is described in ‘Materials and Methods’ section. Extension products were analysed on the 16% denaturating polyacrylamide gel. (C) The primer extension activity of tn2-12p was assayed at 70°C (lanes 1–3) and 80°C (lanes 4 and 5). A 5′-32P-labelled 18-nt primer (GTAAAACGACGGCCAGTG) was hybridized with ssDNA of M13. This primer-template substrate (10 nM) were incubated for 20 min either without any proteins (lane 1), either with 10 μM of tn2-12p (lanes 2 and 4) or with 0.05 U/μl of Taq polymerase (lanes 3 and 5) in the presence of 0.2 mM dNTPs. The buffer used for the polymerization reaction is described in ‘Materials and Methods’ section. Extension products were analysed on the 16% denaturating polyacrylamide gel.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC2926602&req=5

Figure 2: tn2-12p is a DNA polymerase. (A) Lanes 1–4: 5′-32P oligonucleotides of 40, 42, 43 and 45 mers. Lane 5: 5′-32P labelled 20 nt oligonucleotide CGAACCCGTTCTCGGAGCAC, no protein added. The recombinant protein tn2-12p (2.5 and 5 μM, lanes 6 and 7, respectively) or Taq polymerase (Promega, 0.04 U/μl, lane 8) were incubated with this short primer-template substrate hybridized to 42-nt template TTCTGCACAAAGCGGTTCTGCAGTGCTCCGAGAACGGGTTCG. Primers are extended in the presence of 0.2 mM dNTPs during 20 min at 70°C. The buffer used for the polymerization reaction is described in ‘Materials and Methods’ section. Extension products were analysed on the 16% denaturating polyacrylamide gel. Magnification: two very close bands of 42 and 43 bp are clearly visible. (B) The recombinant protein tn2-12p (15 μM, lanes 1 and 2) or Taq polymerase (Promega, 0.02 U/μl, lane 3) were incubated with a short primer-template substrate (5′-32P labelled 20 nt oligonucleotide CGAACCCGTTCTCGGAGCAC hybridized to 42 nt template TTCTGCACAAAGCGGTTCTGCAGTGCTCCGAGAACGGGTTCG). Primers are extended in the presence of 0.2 mM dNTPs (lanes 1 and 3) or 0.2 mM NTPs (lane 2) during 20 min at 70°C. In the control reaction with NTPs (lane 2) no primer elongation was observed. The buffer used for the polymerization reaction is described in ‘Materials and Methods’ section. Extension products were analysed on the 16% denaturating polyacrylamide gel. (C) The primer extension activity of tn2-12p was assayed at 70°C (lanes 1–3) and 80°C (lanes 4 and 5). A 5′-32P-labelled 18-nt primer (GTAAAACGACGGCCAGTG) was hybridized with ssDNA of M13. This primer-template substrate (10 nM) were incubated for 20 min either without any proteins (lane 1), either with 10 μM of tn2-12p (lanes 2 and 4) or with 0.05 U/μl of Taq polymerase (lanes 3 and 5) in the presence of 0.2 mM dNTPs. The buffer used for the polymerization reaction is described in ‘Materials and Methods’ section. Extension products were analysed on the 16% denaturating polyacrylamide gel.

Mentions: Two different 5′-labelled primer-template systems were used (see legend of Figure 2). The standard polymerase assay contained 10 nM primer-template substrate, 2.5–15 µM of tn2-12p (see legend of Figure 2) in 10 mM Tris–HCl pH 9, 1 mM DTT, 50 mM KCl, 0.1% Triton X-100, 50 mM MgCl2 and 0.2 mM dNTPs. The protein was diluted in 50 mM Tris–HCl pH 8, 1 mM DTT, 100 mM NaCl, 0.1 mM EDTA. The significant amount of protein required for the optimal polymerization reaction could be explained by a relatively low stability of the isolated protein. The reactions were allowed to proceed for 20 min at 70 or 80°C and were analysed by denaturating PAGE.


Two novel families of plasmids from hyperthermophilic archaea encoding new families of replication proteins.

Soler N, Marguet E, Cortez D, Desnoues N, Keller J, van Tilbeurgh H, Sezonov G, Forterre P - Nucleic Acids Res. (2010)

tn2-12p is a DNA polymerase. (A) Lanes 1–4: 5′-32P oligonucleotides of 40, 42, 43 and 45 mers. Lane 5: 5′-32P labelled 20 nt oligonucleotide CGAACCCGTTCTCGGAGCAC, no protein added. The recombinant protein tn2-12p (2.5 and 5 μM, lanes 6 and 7, respectively) or Taq polymerase (Promega, 0.04 U/μl, lane 8) were incubated with this short primer-template substrate hybridized to 42-nt template TTCTGCACAAAGCGGTTCTGCAGTGCTCCGAGAACGGGTTCG. Primers are extended in the presence of 0.2 mM dNTPs during 20 min at 70°C. The buffer used for the polymerization reaction is described in ‘Materials and Methods’ section. Extension products were analysed on the 16% denaturating polyacrylamide gel. Magnification: two very close bands of 42 and 43 bp are clearly visible. (B) The recombinant protein tn2-12p (15 μM, lanes 1 and 2) or Taq polymerase (Promega, 0.02 U/μl, lane 3) were incubated with a short primer-template substrate (5′-32P labelled 20 nt oligonucleotide CGAACCCGTTCTCGGAGCAC hybridized to 42 nt template TTCTGCACAAAGCGGTTCTGCAGTGCTCCGAGAACGGGTTCG). Primers are extended in the presence of 0.2 mM dNTPs (lanes 1 and 3) or 0.2 mM NTPs (lane 2) during 20 min at 70°C. In the control reaction with NTPs (lane 2) no primer elongation was observed. The buffer used for the polymerization reaction is described in ‘Materials and Methods’ section. Extension products were analysed on the 16% denaturating polyacrylamide gel. (C) The primer extension activity of tn2-12p was assayed at 70°C (lanes 1–3) and 80°C (lanes 4 and 5). A 5′-32P-labelled 18-nt primer (GTAAAACGACGGCCAGTG) was hybridized with ssDNA of M13. This primer-template substrate (10 nM) were incubated for 20 min either without any proteins (lane 1), either with 10 μM of tn2-12p (lanes 2 and 4) or with 0.05 U/μl of Taq polymerase (lanes 3 and 5) in the presence of 0.2 mM dNTPs. The buffer used for the polymerization reaction is described in ‘Materials and Methods’ section. Extension products were analysed on the 16% denaturating polyacrylamide gel.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC2926602&req=5

Figure 2: tn2-12p is a DNA polymerase. (A) Lanes 1–4: 5′-32P oligonucleotides of 40, 42, 43 and 45 mers. Lane 5: 5′-32P labelled 20 nt oligonucleotide CGAACCCGTTCTCGGAGCAC, no protein added. The recombinant protein tn2-12p (2.5 and 5 μM, lanes 6 and 7, respectively) or Taq polymerase (Promega, 0.04 U/μl, lane 8) were incubated with this short primer-template substrate hybridized to 42-nt template TTCTGCACAAAGCGGTTCTGCAGTGCTCCGAGAACGGGTTCG. Primers are extended in the presence of 0.2 mM dNTPs during 20 min at 70°C. The buffer used for the polymerization reaction is described in ‘Materials and Methods’ section. Extension products were analysed on the 16% denaturating polyacrylamide gel. Magnification: two very close bands of 42 and 43 bp are clearly visible. (B) The recombinant protein tn2-12p (15 μM, lanes 1 and 2) or Taq polymerase (Promega, 0.02 U/μl, lane 3) were incubated with a short primer-template substrate (5′-32P labelled 20 nt oligonucleotide CGAACCCGTTCTCGGAGCAC hybridized to 42 nt template TTCTGCACAAAGCGGTTCTGCAGTGCTCCGAGAACGGGTTCG). Primers are extended in the presence of 0.2 mM dNTPs (lanes 1 and 3) or 0.2 mM NTPs (lane 2) during 20 min at 70°C. In the control reaction with NTPs (lane 2) no primer elongation was observed. The buffer used for the polymerization reaction is described in ‘Materials and Methods’ section. Extension products were analysed on the 16% denaturating polyacrylamide gel. (C) The primer extension activity of tn2-12p was assayed at 70°C (lanes 1–3) and 80°C (lanes 4 and 5). A 5′-32P-labelled 18-nt primer (GTAAAACGACGGCCAGTG) was hybridized with ssDNA of M13. This primer-template substrate (10 nM) were incubated for 20 min either without any proteins (lane 1), either with 10 μM of tn2-12p (lanes 2 and 4) or with 0.05 U/μl of Taq polymerase (lanes 3 and 5) in the presence of 0.2 mM dNTPs. The buffer used for the polymerization reaction is described in ‘Materials and Methods’ section. Extension products were analysed on the 16% denaturating polyacrylamide gel.
Mentions: Two different 5′-labelled primer-template systems were used (see legend of Figure 2). The standard polymerase assay contained 10 nM primer-template substrate, 2.5–15 µM of tn2-12p (see legend of Figure 2) in 10 mM Tris–HCl pH 9, 1 mM DTT, 50 mM KCl, 0.1% Triton X-100, 50 mM MgCl2 and 0.2 mM dNTPs. The protein was diluted in 50 mM Tris–HCl pH 8, 1 mM DTT, 100 mM NaCl, 0.1 mM EDTA. The significant amount of protein required for the optimal polymerization reaction could be explained by a relatively low stability of the isolated protein. The reactions were allowed to proceed for 20 min at 70 or 80°C and were analysed by denaturating PAGE.

Bottom Line: The plasmid pT26-2 from Thermococcus sp. 26-2 (21.5 kb), that corresponds to another plasmid family, encodes many proteins having homologues in virus-like elements integrated in several genomes of Thermococcales and Methanococcales.Whereas all plasmids previously isolated from Thermococcales replicate by the rolling circle mechanism, the three plasmids described here probably replicate by the theta mechanism.The plasmids pTN2 and pP12-1 encode a putative helicase of the SFI superfamily and a new family of DNA polymerase, whose activity was demonstrated in vitro, whereas pT26-2 encodes a putative new type of helicase.

View Article: PubMed Central - PubMed

Affiliation: Institut de Génétique et Microbiologie, Univ Paris-Sud, Orsay, France. nicolas.soler@inserm.fr

ABSTRACT
Thermococcales (phylum Euryarchaeota) are model organisms for physiological and molecular studies of hyperthermophiles. Here we describe three new plasmids from Thermococcales that could provide new tools and model systems for genetic and molecular studies in Archaea. The plasmids pTN2 from Thermococcus nautilus sp. 30-1 and pP12-1 from Pyrococcus sp. 12-1 belong to the same family. They have similar size (approximately 12 kb) and share six genes, including homologues of genes encoded by the virus PAV1 from Pyrococcus abyssi. The plasmid pT26-2 from Thermococcus sp. 26-2 (21.5 kb), that corresponds to another plasmid family, encodes many proteins having homologues in virus-like elements integrated in several genomes of Thermococcales and Methanococcales. Our analyses confirm that viruses and plasmids are evolutionary related and co-evolve with their hosts. Whereas all plasmids previously isolated from Thermococcales replicate by the rolling circle mechanism, the three plasmids described here probably replicate by the theta mechanism. The plasmids pTN2 and pP12-1 encode a putative helicase of the SFI superfamily and a new family of DNA polymerase, whose activity was demonstrated in vitro, whereas pT26-2 encodes a putative new type of helicase. This strengthens the idea that plasmids and viruses are a reservoir of novel protein families involved in DNA replication.

Show MeSH
Related in: MedlinePlus