Limits...
An L1 box binding protein, GbML1, interacts with GbMYB25 to control cotton fibre development.

Zhang F, Zuo K, Zhang J, Liu X, Zhang L, Sun X, Tang K - J. Exp. Bot. (2010)

Bottom Line: GbML1 overexpression in Arabidopsis increased the number of trichomes on stems and leaves and increased the accumulation of anthocyanin in leaves.Taken together, the L1 box binding protein, GbML1 was identified as the first partner for GbMYB25 and the role of START domain was discovered to be a protein binding domain in plants.Our findings will help the improvement of cotton fibre production and the understanding of the key role of HD-Zip family and MYB family in plants.

View Article: PubMed Central - PubMed

Affiliation: Plant Biotechnology Research Center, Fudan-SJTU-Nottingham Plant Biotechnology R&D Center, School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai 200240, People's Republic of China.

ABSTRACT
Transcription factors play key roles in plant development through their interaction with cis-elements and/or other transcription factors. A HD-Zip IV family transcription factor, Gossypium barbadense Meristem Layer 1 (GbML1) has been identified and characterized here. GbML1 specifically bound to the L1 box and the promoters of GbML1 and GbRDL1. GbML1 physically interacted with a key regulator of cotton fibre development, GbMYB25. Truncated and point mutation assays indicated the START-SAD domain was required for the binding to the C terminal domain (CTD) of GbMYB25. GbML1 overexpression in Arabidopsis increased the number of trichomes on stems and leaves and increased the accumulation of anthocyanin in leaves. Taken together, the L1 box binding protein, GbML1 was identified as the first partner for GbMYB25 and the role of START domain was discovered to be a protein binding domain in plants. Our findings will help the improvement of cotton fibre production and the understanding of the key role of HD-Zip family and MYB family in plants.

Show MeSH

Related in: MedlinePlus

GbML1 binds to the L1 box in vitro. (A) Interaction of GbML1 protein with the L1 box. 1–3: Controls provided by the kit. 1, No protein, biotin-ENBL probe; 2, ENBL, biotin-ENBL probe; 3, ENBL, biotin-ENBL probe and 100× ENBL cold competitor. 4–6, binding assay for GbML1;. 4, MBP, biotin-L1 probe (L1: TGTAAATGCACCTGCAACACA); 5, GbML1, biotin-L1 probe; 6, GbML1, biotin ml1 probe (mL1:TGTAAGGGCACCTGCAACACA). (B) Reduced probe concentration results in weaker binding. 2, 2×dilution; 3, 4×dilution; 4, 8× dilution. (C) HD-ZLZ domains are required and sufficient for binding to the L1 box. Binding reaction includes biotin-labelled L1 box probe with different MBP fusion proteins: 1, MBP protein; 2, MBP-GbML1 protein; 3, MBP-HD protein; 4, MBP-HD-ZLZ protein; 5, MBP-START–SAD protein. (D) Point mutations in the third helix affect the binding of HD-ZLZ to L1 box. Left: Diagram of the point mutation and proteins used in EMSA. Right, EMSA assay. The number above is correlated to the number of the proteins diagramed. (E) GbML1 binds to the L1 box containing promoters from cotton. (F) ZLZ domain confers homodimer formation. left: Diagram of different constructs used for the yeast two-hybrid assay; right, yeasts harbouring BD-GbML1/AD-HD or BD-GbML1/AD-ZLZ grown on selective plates as indicated. Control medium: –2 (SD/-T-L); selective medium: –3 (SD/-T-L-H), 10 mM (–3 supplemented with 10 mM 3-AT), –4 (SD/-T-L-H-A). The control is yeast transformed with BD-GbML1/AD.
© Copyright Policy - open-access
Related In: Results  -  Collection

License 1 - License 2
getmorefigures.php?uid=PMC2921199&req=5

fig2: GbML1 binds to the L1 box in vitro. (A) Interaction of GbML1 protein with the L1 box. 1–3: Controls provided by the kit. 1, No protein, biotin-ENBL probe; 2, ENBL, biotin-ENBL probe; 3, ENBL, biotin-ENBL probe and 100× ENBL cold competitor. 4–6, binding assay for GbML1;. 4, MBP, biotin-L1 probe (L1: TGTAAATGCACCTGCAACACA); 5, GbML1, biotin-L1 probe; 6, GbML1, biotin ml1 probe (mL1:TGTAAGGGCACCTGCAACACA). (B) Reduced probe concentration results in weaker binding. 2, 2×dilution; 3, 4×dilution; 4, 8× dilution. (C) HD-ZLZ domains are required and sufficient for binding to the L1 box. Binding reaction includes biotin-labelled L1 box probe with different MBP fusion proteins: 1, MBP protein; 2, MBP-GbML1 protein; 3, MBP-HD protein; 4, MBP-HD-ZLZ protein; 5, MBP-START–SAD protein. (D) Point mutations in the third helix affect the binding of HD-ZLZ to L1 box. Left: Diagram of the point mutation and proteins used in EMSA. Right, EMSA assay. The number above is correlated to the number of the proteins diagramed. (E) GbML1 binds to the L1 box containing promoters from cotton. (F) ZLZ domain confers homodimer formation. left: Diagram of different constructs used for the yeast two-hybrid assay; right, yeasts harbouring BD-GbML1/AD-HD or BD-GbML1/AD-ZLZ grown on selective plates as indicated. Control medium: –2 (SD/-T-L); selective medium: –3 (SD/-T-L-H), 10 mM (–3 supplemented with 10 mM 3-AT), –4 (SD/-T-L-H-A). The control is yeast transformed with BD-GbML1/AD.

Mentions: Previous studies demonstrated that recombinant ATML1 and PDF2 proteins could bind to the L1 box in vitro (Abe et al., 2001, 2003). EMSA assays were performed by using purified full-length or truncated GbML1 proteins (see Supplementary Fig. S2A at JXB online). Complex formation was observed with the GbML1 (Fig. 2A, lane 5; Fig. 2B) and HD-ZLZ proteins (Fig. 2C, lane 4) but not with the MBP (Fig. 2A, lane 4) or the HD (Fig. 2C, lane 3), START–SAD proteins (Fig. 2C, lane 5). No complex formation was observed with the mutated L1 box (Fig. 2A, lane 6). The third helix of the HD domain was shown to contact the double-stranded DNA, and was important for protein–DNA interaction. Two mutations were made in this region, L94P and N107I (Fig. 2D, left; see Supplementary Fig. S2B at JXB online). While the L94P mutation greatly reduced the interaction between the HD-ZLZ protein and the L1 box, the N107I mutation abolished the interaction (Fig. 2D, right). Moreover, GbML1 could bind to the L1 box containing parts from GaRDL1 (Li et al., 2002) and GbML1 promoters in vitro (Fig. 2E; see Supplementary Fig. S3 at JXB online). These results indicate that GbML1 can specifically bind to L1 box and may specify the gene expression in the L1 layer.


An L1 box binding protein, GbML1, interacts with GbMYB25 to control cotton fibre development.

Zhang F, Zuo K, Zhang J, Liu X, Zhang L, Sun X, Tang K - J. Exp. Bot. (2010)

GbML1 binds to the L1 box in vitro. (A) Interaction of GbML1 protein with the L1 box. 1–3: Controls provided by the kit. 1, No protein, biotin-ENBL probe; 2, ENBL, biotin-ENBL probe; 3, ENBL, biotin-ENBL probe and 100× ENBL cold competitor. 4–6, binding assay for GbML1;. 4, MBP, biotin-L1 probe (L1: TGTAAATGCACCTGCAACACA); 5, GbML1, biotin-L1 probe; 6, GbML1, biotin ml1 probe (mL1:TGTAAGGGCACCTGCAACACA). (B) Reduced probe concentration results in weaker binding. 2, 2×dilution; 3, 4×dilution; 4, 8× dilution. (C) HD-ZLZ domains are required and sufficient for binding to the L1 box. Binding reaction includes biotin-labelled L1 box probe with different MBP fusion proteins: 1, MBP protein; 2, MBP-GbML1 protein; 3, MBP-HD protein; 4, MBP-HD-ZLZ protein; 5, MBP-START–SAD protein. (D) Point mutations in the third helix affect the binding of HD-ZLZ to L1 box. Left: Diagram of the point mutation and proteins used in EMSA. Right, EMSA assay. The number above is correlated to the number of the proteins diagramed. (E) GbML1 binds to the L1 box containing promoters from cotton. (F) ZLZ domain confers homodimer formation. left: Diagram of different constructs used for the yeast two-hybrid assay; right, yeasts harbouring BD-GbML1/AD-HD or BD-GbML1/AD-ZLZ grown on selective plates as indicated. Control medium: –2 (SD/-T-L); selective medium: –3 (SD/-T-L-H), 10 mM (–3 supplemented with 10 mM 3-AT), –4 (SD/-T-L-H-A). The control is yeast transformed with BD-GbML1/AD.
© Copyright Policy - open-access
Related In: Results  -  Collection

License 1 - License 2
Show All Figures
getmorefigures.php?uid=PMC2921199&req=5

fig2: GbML1 binds to the L1 box in vitro. (A) Interaction of GbML1 protein with the L1 box. 1–3: Controls provided by the kit. 1, No protein, biotin-ENBL probe; 2, ENBL, biotin-ENBL probe; 3, ENBL, biotin-ENBL probe and 100× ENBL cold competitor. 4–6, binding assay for GbML1;. 4, MBP, biotin-L1 probe (L1: TGTAAATGCACCTGCAACACA); 5, GbML1, biotin-L1 probe; 6, GbML1, biotin ml1 probe (mL1:TGTAAGGGCACCTGCAACACA). (B) Reduced probe concentration results in weaker binding. 2, 2×dilution; 3, 4×dilution; 4, 8× dilution. (C) HD-ZLZ domains are required and sufficient for binding to the L1 box. Binding reaction includes biotin-labelled L1 box probe with different MBP fusion proteins: 1, MBP protein; 2, MBP-GbML1 protein; 3, MBP-HD protein; 4, MBP-HD-ZLZ protein; 5, MBP-START–SAD protein. (D) Point mutations in the third helix affect the binding of HD-ZLZ to L1 box. Left: Diagram of the point mutation and proteins used in EMSA. Right, EMSA assay. The number above is correlated to the number of the proteins diagramed. (E) GbML1 binds to the L1 box containing promoters from cotton. (F) ZLZ domain confers homodimer formation. left: Diagram of different constructs used for the yeast two-hybrid assay; right, yeasts harbouring BD-GbML1/AD-HD or BD-GbML1/AD-ZLZ grown on selective plates as indicated. Control medium: –2 (SD/-T-L); selective medium: –3 (SD/-T-L-H), 10 mM (–3 supplemented with 10 mM 3-AT), –4 (SD/-T-L-H-A). The control is yeast transformed with BD-GbML1/AD.
Mentions: Previous studies demonstrated that recombinant ATML1 and PDF2 proteins could bind to the L1 box in vitro (Abe et al., 2001, 2003). EMSA assays were performed by using purified full-length or truncated GbML1 proteins (see Supplementary Fig. S2A at JXB online). Complex formation was observed with the GbML1 (Fig. 2A, lane 5; Fig. 2B) and HD-ZLZ proteins (Fig. 2C, lane 4) but not with the MBP (Fig. 2A, lane 4) or the HD (Fig. 2C, lane 3), START–SAD proteins (Fig. 2C, lane 5). No complex formation was observed with the mutated L1 box (Fig. 2A, lane 6). The third helix of the HD domain was shown to contact the double-stranded DNA, and was important for protein–DNA interaction. Two mutations were made in this region, L94P and N107I (Fig. 2D, left; see Supplementary Fig. S2B at JXB online). While the L94P mutation greatly reduced the interaction between the HD-ZLZ protein and the L1 box, the N107I mutation abolished the interaction (Fig. 2D, right). Moreover, GbML1 could bind to the L1 box containing parts from GaRDL1 (Li et al., 2002) and GbML1 promoters in vitro (Fig. 2E; see Supplementary Fig. S3 at JXB online). These results indicate that GbML1 can specifically bind to L1 box and may specify the gene expression in the L1 layer.

Bottom Line: GbML1 overexpression in Arabidopsis increased the number of trichomes on stems and leaves and increased the accumulation of anthocyanin in leaves.Taken together, the L1 box binding protein, GbML1 was identified as the first partner for GbMYB25 and the role of START domain was discovered to be a protein binding domain in plants.Our findings will help the improvement of cotton fibre production and the understanding of the key role of HD-Zip family and MYB family in plants.

View Article: PubMed Central - PubMed

Affiliation: Plant Biotechnology Research Center, Fudan-SJTU-Nottingham Plant Biotechnology R&D Center, School of Agriculture and Biology, Shanghai Jiao Tong University, Shanghai 200240, People's Republic of China.

ABSTRACT
Transcription factors play key roles in plant development through their interaction with cis-elements and/or other transcription factors. A HD-Zip IV family transcription factor, Gossypium barbadense Meristem Layer 1 (GbML1) has been identified and characterized here. GbML1 specifically bound to the L1 box and the promoters of GbML1 and GbRDL1. GbML1 physically interacted with a key regulator of cotton fibre development, GbMYB25. Truncated and point mutation assays indicated the START-SAD domain was required for the binding to the C terminal domain (CTD) of GbMYB25. GbML1 overexpression in Arabidopsis increased the number of trichomes on stems and leaves and increased the accumulation of anthocyanin in leaves. Taken together, the L1 box binding protein, GbML1 was identified as the first partner for GbMYB25 and the role of START domain was discovered to be a protein binding domain in plants. Our findings will help the improvement of cotton fibre production and the understanding of the key role of HD-Zip family and MYB family in plants.

Show MeSH
Related in: MedlinePlus