Limits...
Investigations on a clinically and functionally unusual and novel germline p53 mutation.

Rutherford J, Chu CE, Duddy PM, Charlton RS, Chumas P, Taylor GR, Lu X, Barnes DM, Camplejohn RS - Br. J. Cancer (2002)

Bottom Line: Surprisingly two assays of p53 function gave apparently wild-type results on peripheral blood lymphocytes from this individual.These results led us to carry out more detailed functional tests on the mutant protein.However, surprisingly, data from irradiated peripheral blood lymphocytes and transfected Saos-2 cells, suggested that this truncated, mutant protein retains significant ability to induce apoptosis.

View Article: PubMed Central - PubMed

Affiliation: Richard Dimbleby Department Cancer Research, Guy's, King's and St Thomas' School of Medicine, St Thomas' Hospital, London SE1 7EH, UK.

Show MeSH

Related in: MedlinePlus

Genomic sequence. Analysis of genomic DNA was carried out from peripheral blood lymphocytes by direct sequencing of double stranded PCR products. A frameshift could be clearly seen starting after nucleotide 13160 in exon 5 (denoted by ↓). The insertion was found to be 7 base pairs in length and was a repeat of the 7 base pair sequence immediately before it. This frameshift would produce amino acid substitutions beginning with alanine to glycine at position 161 and a stop at position 182. Wild-type: CGCGCCATGGCCATCTA; Mutant: CGCGCCATGGGCCATGGCCATCTA
© Copyright Policy
Related In: Results  -  Collection


getmorefigures.php?uid=PMC2746598&req=5

fig2: Genomic sequence. Analysis of genomic DNA was carried out from peripheral blood lymphocytes by direct sequencing of double stranded PCR products. A frameshift could be clearly seen starting after nucleotide 13160 in exon 5 (denoted by ↓). The insertion was found to be 7 base pairs in length and was a repeat of the 7 base pair sequence immediately before it. This frameshift would produce amino acid substitutions beginning with alanine to glycine at position 161 and a stop at position 182. Wild-type: CGCGCCATGGCCATCTA; Mutant: CGCGCCATGGGCCATGGCCATCTA

Mentions: Genomic sequencing of DNA from PBL was carried out in both directions in two independent laboratories from exon 5 through to exon 9. A frameshift mutation, the result of a 7 base pair insertion, was discovered in exon 5 of the p53 gene, after the first base of codon 161 (Figure 2Figure 2


Investigations on a clinically and functionally unusual and novel germline p53 mutation.

Rutherford J, Chu CE, Duddy PM, Charlton RS, Chumas P, Taylor GR, Lu X, Barnes DM, Camplejohn RS - Br. J. Cancer (2002)

Genomic sequence. Analysis of genomic DNA was carried out from peripheral blood lymphocytes by direct sequencing of double stranded PCR products. A frameshift could be clearly seen starting after nucleotide 13160 in exon 5 (denoted by ↓). The insertion was found to be 7 base pairs in length and was a repeat of the 7 base pair sequence immediately before it. This frameshift would produce amino acid substitutions beginning with alanine to glycine at position 161 and a stop at position 182. Wild-type: CGCGCCATGGCCATCTA; Mutant: CGCGCCATGGGCCATGGCCATCTA
© Copyright Policy
Related In: Results  -  Collection

Show All Figures
getmorefigures.php?uid=PMC2746598&req=5

fig2: Genomic sequence. Analysis of genomic DNA was carried out from peripheral blood lymphocytes by direct sequencing of double stranded PCR products. A frameshift could be clearly seen starting after nucleotide 13160 in exon 5 (denoted by ↓). The insertion was found to be 7 base pairs in length and was a repeat of the 7 base pair sequence immediately before it. This frameshift would produce amino acid substitutions beginning with alanine to glycine at position 161 and a stop at position 182. Wild-type: CGCGCCATGGCCATCTA; Mutant: CGCGCCATGGGCCATGGCCATCTA
Mentions: Genomic sequencing of DNA from PBL was carried out in both directions in two independent laboratories from exon 5 through to exon 9. A frameshift mutation, the result of a 7 base pair insertion, was discovered in exon 5 of the p53 gene, after the first base of codon 161 (Figure 2Figure 2

Bottom Line: Surprisingly two assays of p53 function gave apparently wild-type results on peripheral blood lymphocytes from this individual.These results led us to carry out more detailed functional tests on the mutant protein.However, surprisingly, data from irradiated peripheral blood lymphocytes and transfected Saos-2 cells, suggested that this truncated, mutant protein retains significant ability to induce apoptosis.

View Article: PubMed Central - PubMed

Affiliation: Richard Dimbleby Department Cancer Research, Guy's, King's and St Thomas' School of Medicine, St Thomas' Hospital, London SE1 7EH, UK.

Show MeSH
Related in: MedlinePlus