Limits...
Male mice with deleted Wolframin (Wfs1) gene have reduced fertility.

Noormets K, Kõks S, Kavak A, Arend A, Aunapuu M, Keldrimaa A, Vasar E, Tillmann V - Reprod. Biol. Endocrinol. (2009)

Bottom Line: Serum testosterone and FSH concentrations were also measured.The pregnancy rate in wt females mated with Wfs1KO males was significantly lower than in the control group (15% vs. 32%; p < 0.05), but there was no significant difference in litter size.Serum testosterone and FSH concentrations did not differ between the two groups.

View Article: PubMed Central - HTML - PubMed

Affiliation: Department of Paediatrics, University of Tartu, 6 Lunini Street, 51014 Tartu, Estonia. klari.noormets@ut.ee

ABSTRACT

Background: Wolfram Syndrome (WS) is an autosomal recessive disorder characterised by non-autoimmune diabetes mellitus, optic atrophy, cranial diabetes insipidus and sensorineural deafness. Some reports have described hypogonadism in male WS patients. The aim of our study was to find out whether Wfs1 deficient (Wfs1KO) male mice have reduced fertility and, if so, to examine possible causes.

Methods: Wfs1KO mice were generated by homologous recombination. Both Wfs1KO and wild type (wt) male mice were mated with wt female mice. The number of litters and the number of pups were counted and pregnancy rates calculated. The motility and morphology of the sperm and the histology of testes were analysed. Serum testosterone and FSH concentrations were also measured.

Results: The pregnancy rate in wt females mated with Wfs1KO males was significantly lower than in the control group (15% vs. 32%; p < 0.05), but there was no significant difference in litter size. Analysis of male fertility showed that, in the Wfs1KO group, eight males out of 13 had pups whereas in the control group all 13 males had at least one litter. Sperm motility was not affected in Wfs1KO mice, but Wfs1KO males had less proximal bent tails (14.4 +/- 1.2% vs. 21.5 +/- 1.3 p < 0.05) and less abnormal sperm heads (22.8 +/- 1.8 vs. 31.5 +/- 3.5, p < 0.05) than wt males. Testes histology revealed significantly reduced number of spermatogonia (23.9 +/- 4.9 vs. 38.1 +/- 2.8; p < 0.05) and Sertoli cells (6.4 +/- 0.5 vs. 9.2 +/- 1.0; p < 0.05) in Wfs1KO mice. Serum testosterone and FSH concentrations did not differ between the two groups.

Conclusion: The impaired fertility of Wfs1KO male mice is most likely due to changes in sperm morphology and reduced number of spermatogenic cells. The exact mechanism through which the Wfs1 gene influences sperm morphology needs to be clarified in further studies.

Show MeSH

Related in: MedlinePlus

Gel electrophoresis of PCR product to genotype wfs1 targeting products. Mice were genotyped by multiplex PCR for both alleles using primers Wfs1KO_wf2 5' TTGGCTTGTATTTGTCGGCC 3', NeoR1 5' GACCGCTATCAGGACATAGCG 3' and WfsKO_uniR2 5' CCCATCCTGCTCTCTGAACC 3'. The upper band is for the wild-type allele; the lower band is for the mutant allele. The presence of two bands indicates a heterozygous mutant mouse.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC2734842&req=5

Figure 2: Gel electrophoresis of PCR product to genotype wfs1 targeting products. Mice were genotyped by multiplex PCR for both alleles using primers Wfs1KO_wf2 5' TTGGCTTGTATTTGTCGGCC 3', NeoR1 5' GACCGCTATCAGGACATAGCG 3' and WfsKO_uniR2 5' CCCATCCTGCTCTCTGAACC 3'. The upper band is for the wild-type allele; the lower band is for the mutant allele. The presence of two bands indicates a heterozygous mutant mouse.

Mentions: Wfs1 deficient (Wfs1KO) mice were generated by targeting construct to replace most of the coding region of the wfs1 gene (Figure 1). Briefly, the 8.8 kb BamHI restriction fragment from the PAC clone 391-J24 (RPCI21 library, MRC UK HGMP Resource Centre, UK) was subcloned into a pGem11 cloning plasmid (Promega, Madison, WI). We replaced the 3.7-kb NcoI fragment with an in-frame NLSLacZNeo cassette. This resulted in the deletion of amino acids 360–890 in the Wfs1 protein and a fusion between the Wfs1 1–360 fragment and LacZ. This construct was inserted into W4/129S6 embryonic stem (ES) cells (Taconic, Hudson, NY) at the Biocenter of the University of Oulu . Colonies resistant to G418 and gancyclovir were screened for homologous recombination by polymerase chain reaction (PCR) by using the recombination-specific primers NeoR1 5'GACCGCTATCAGGACA TAGCG3' and Wfs1_WTR1 5'AGGACTCAGGTTCTGCCTCA3' (Figure 2). We sequenced the PCR product to verify that homologous recombination took place, and injected ES clone 8A2 into C57BL/6 blastocysts. The invalidation of Wfs1 gene was verified by mRNA expression analysis and we confirmed the lack of Wfs1 transcript in homozygous Wfs1 mutant mice [13] (Figure 3).


Male mice with deleted Wolframin (Wfs1) gene have reduced fertility.

Noormets K, Kõks S, Kavak A, Arend A, Aunapuu M, Keldrimaa A, Vasar E, Tillmann V - Reprod. Biol. Endocrinol. (2009)

Gel electrophoresis of PCR product to genotype wfs1 targeting products. Mice were genotyped by multiplex PCR for both alleles using primers Wfs1KO_wf2 5' TTGGCTTGTATTTGTCGGCC 3', NeoR1 5' GACCGCTATCAGGACATAGCG 3' and WfsKO_uniR2 5' CCCATCCTGCTCTCTGAACC 3'. The upper band is for the wild-type allele; the lower band is for the mutant allele. The presence of two bands indicates a heterozygous mutant mouse.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC2734842&req=5

Figure 2: Gel electrophoresis of PCR product to genotype wfs1 targeting products. Mice were genotyped by multiplex PCR for both alleles using primers Wfs1KO_wf2 5' TTGGCTTGTATTTGTCGGCC 3', NeoR1 5' GACCGCTATCAGGACATAGCG 3' and WfsKO_uniR2 5' CCCATCCTGCTCTCTGAACC 3'. The upper band is for the wild-type allele; the lower band is for the mutant allele. The presence of two bands indicates a heterozygous mutant mouse.
Mentions: Wfs1 deficient (Wfs1KO) mice were generated by targeting construct to replace most of the coding region of the wfs1 gene (Figure 1). Briefly, the 8.8 kb BamHI restriction fragment from the PAC clone 391-J24 (RPCI21 library, MRC UK HGMP Resource Centre, UK) was subcloned into a pGem11 cloning plasmid (Promega, Madison, WI). We replaced the 3.7-kb NcoI fragment with an in-frame NLSLacZNeo cassette. This resulted in the deletion of amino acids 360–890 in the Wfs1 protein and a fusion between the Wfs1 1–360 fragment and LacZ. This construct was inserted into W4/129S6 embryonic stem (ES) cells (Taconic, Hudson, NY) at the Biocenter of the University of Oulu . Colonies resistant to G418 and gancyclovir were screened for homologous recombination by polymerase chain reaction (PCR) by using the recombination-specific primers NeoR1 5'GACCGCTATCAGGACA TAGCG3' and Wfs1_WTR1 5'AGGACTCAGGTTCTGCCTCA3' (Figure 2). We sequenced the PCR product to verify that homologous recombination took place, and injected ES clone 8A2 into C57BL/6 blastocysts. The invalidation of Wfs1 gene was verified by mRNA expression analysis and we confirmed the lack of Wfs1 transcript in homozygous Wfs1 mutant mice [13] (Figure 3).

Bottom Line: Serum testosterone and FSH concentrations were also measured.The pregnancy rate in wt females mated with Wfs1KO males was significantly lower than in the control group (15% vs. 32%; p < 0.05), but there was no significant difference in litter size.Serum testosterone and FSH concentrations did not differ between the two groups.

View Article: PubMed Central - HTML - PubMed

Affiliation: Department of Paediatrics, University of Tartu, 6 Lunini Street, 51014 Tartu, Estonia. klari.noormets@ut.ee

ABSTRACT

Background: Wolfram Syndrome (WS) is an autosomal recessive disorder characterised by non-autoimmune diabetes mellitus, optic atrophy, cranial diabetes insipidus and sensorineural deafness. Some reports have described hypogonadism in male WS patients. The aim of our study was to find out whether Wfs1 deficient (Wfs1KO) male mice have reduced fertility and, if so, to examine possible causes.

Methods: Wfs1KO mice were generated by homologous recombination. Both Wfs1KO and wild type (wt) male mice were mated with wt female mice. The number of litters and the number of pups were counted and pregnancy rates calculated. The motility and morphology of the sperm and the histology of testes were analysed. Serum testosterone and FSH concentrations were also measured.

Results: The pregnancy rate in wt females mated with Wfs1KO males was significantly lower than in the control group (15% vs. 32%; p < 0.05), but there was no significant difference in litter size. Analysis of male fertility showed that, in the Wfs1KO group, eight males out of 13 had pups whereas in the control group all 13 males had at least one litter. Sperm motility was not affected in Wfs1KO mice, but Wfs1KO males had less proximal bent tails (14.4 +/- 1.2% vs. 21.5 +/- 1.3 p < 0.05) and less abnormal sperm heads (22.8 +/- 1.8 vs. 31.5 +/- 3.5, p < 0.05) than wt males. Testes histology revealed significantly reduced number of spermatogonia (23.9 +/- 4.9 vs. 38.1 +/- 2.8; p < 0.05) and Sertoli cells (6.4 +/- 0.5 vs. 9.2 +/- 1.0; p < 0.05) in Wfs1KO mice. Serum testosterone and FSH concentrations did not differ between the two groups.

Conclusion: The impaired fertility of Wfs1KO male mice is most likely due to changes in sperm morphology and reduced number of spermatogenic cells. The exact mechanism through which the Wfs1 gene influences sperm morphology needs to be clarified in further studies.

Show MeSH
Related in: MedlinePlus