Limits...
Agronomic performance and transcriptional analysis of carotenoid biosynthesis in fruits of transgenic HighCaro and control tomato lines under field conditions.

Giorio G, Stigliani AL, D'Ambrosio C - Transgenic Res. (2006)

Bottom Line: One of the most significant achievements was "HighCaro (HC)," a transgenic tomato plant constitutively expressing the tomato lycopene beta-cyclase (tLcy-b), that produces orange fruits due to the complete conversion of lycopene to beta-carotene.Unexpectedly, Lcy-b expression in transgenic fruits was also developmentally regulated, despite the fact that the gene was driven by a constitutive promoter.Our data provide evidence that in photosynthetic cells a strict and aspecific mechanism controls the level of transcripts until the onset of chromoplasts differentiation, at which point a gene-specific control on transcription takes place.

View Article: PubMed Central - PubMed

Affiliation: Metapontum Agrobios, S.S. Jonica 106, Km 448.2, Metaponto, MT , 75010, Italy. ggiorio@agrobios.it

ABSTRACT
Genetic manipulation of carotenoid biosynthesis in higher plants has been the objective of a number of biotechnology programs, e.g. the Golden Rice Program. However, tomato (Solanum lycopersicum L.), which naturally accumulates lycopene in fruits, has attracted the attention of many groups who have manipulated it to increase or diversify carotenoid accumulation. One of the most significant achievements was "HighCaro (HC)," a transgenic tomato plant constitutively expressing the tomato lycopene beta-cyclase (tLcy-b), that produces orange fruits due to the complete conversion of lycopene to beta-carotene. In this article we report the results of a field trial conducted in Metaponto (Italy) on HC and on two control genotypes to evaluate the stability of the transgenic trait and their yield performances. Transcriptional regulation of eight genes involved in carotenogenesis was assayed by quantitative real-time PCR (qRT-PCR) analysis on fruits collected at four distinct development stages. Statistical analysis results demonstrated that in field conditions the transgene maintained its ability to induce the conversion of lycopene to beta-carotene. Moreover, agronomic performances and fruit quality in the transgenic line were not impaired by this metabolic disturbance. Results of qRT-PCR analysis suggested that transcription of PSY-1, PDS and ZDS genes were developmentally regulated in both genotypes. Unexpectedly, Lcy-b expression in transgenic fruits was also developmentally regulated, despite the fact that the gene was driven by a constitutive promoter. Our data provide evidence that in photosynthetic cells a strict and aspecific mechanism controls the level of transcripts until the onset of chromoplasts differentiation, at which point a gene-specific control on transcription takes place.

Show MeSH

Related in: MedlinePlus

Fruits of transgenic (HighCaro) and control (Red Setter) lines sampled at the mature green and the ripe stages for the extraction of RNA. (a) Fruits at mature green stage from the plots 25 (Red Setter) and 27 (HighCaro). Fruits of HighCaro (b) and Red Setter (c) lines at ripe stage sampled from the four replicates
© Copyright Policy
Related In: Results  -  Collection


getmorefigures.php?uid=PMC2734263&req=5

Fig2: Fruits of transgenic (HighCaro) and control (Red Setter) lines sampled at the mature green and the ripe stages for the extraction of RNA. (a) Fruits at mature green stage from the plots 25 (Red Setter) and 27 (HighCaro). Fruits of HighCaro (b) and Red Setter (c) lines at ripe stage sampled from the four replicates

Mentions: Fruits were collected at four development stages (mature green, breaker, pink and ripe) (Bedbrook et al. 1999) from four plots for each genotype in such a way as to fulfil the requirements for a RCBD. For each RNA sample, at least eight fruits were collected from the same plot and cut in two parts to inspect the pericarp colour (Fig. 2). A piece of pericarp from the four most uniform fruits was excised to form the bulk for total RNA extraction (López-Gómez and Gómez-Lim 1992). Leaves for total RNA extraction were collected from the same plots on plants prior to flowering. DNA contamination was removed from RNA extracts using the DNA-Free kit (Ambion, Austin, TX, USA). A PCR was carried out with a pair of primers specific for the 18S rRNA gene (forward: GCATTTGCCAAGGATGTTTT; reverse: TAGCAGGCTGAGGTCTCGTT) to test the efficiency of DNA removal.Fig. 2


Agronomic performance and transcriptional analysis of carotenoid biosynthesis in fruits of transgenic HighCaro and control tomato lines under field conditions.

Giorio G, Stigliani AL, D'Ambrosio C - Transgenic Res. (2006)

Fruits of transgenic (HighCaro) and control (Red Setter) lines sampled at the mature green and the ripe stages for the extraction of RNA. (a) Fruits at mature green stage from the plots 25 (Red Setter) and 27 (HighCaro). Fruits of HighCaro (b) and Red Setter (c) lines at ripe stage sampled from the four replicates
© Copyright Policy
Related In: Results  -  Collection

Show All Figures
getmorefigures.php?uid=PMC2734263&req=5

Fig2: Fruits of transgenic (HighCaro) and control (Red Setter) lines sampled at the mature green and the ripe stages for the extraction of RNA. (a) Fruits at mature green stage from the plots 25 (Red Setter) and 27 (HighCaro). Fruits of HighCaro (b) and Red Setter (c) lines at ripe stage sampled from the four replicates
Mentions: Fruits were collected at four development stages (mature green, breaker, pink and ripe) (Bedbrook et al. 1999) from four plots for each genotype in such a way as to fulfil the requirements for a RCBD. For each RNA sample, at least eight fruits were collected from the same plot and cut in two parts to inspect the pericarp colour (Fig. 2). A piece of pericarp from the four most uniform fruits was excised to form the bulk for total RNA extraction (López-Gómez and Gómez-Lim 1992). Leaves for total RNA extraction were collected from the same plots on plants prior to flowering. DNA contamination was removed from RNA extracts using the DNA-Free kit (Ambion, Austin, TX, USA). A PCR was carried out with a pair of primers specific for the 18S rRNA gene (forward: GCATTTGCCAAGGATGTTTT; reverse: TAGCAGGCTGAGGTCTCGTT) to test the efficiency of DNA removal.Fig. 2

Bottom Line: One of the most significant achievements was "HighCaro (HC)," a transgenic tomato plant constitutively expressing the tomato lycopene beta-cyclase (tLcy-b), that produces orange fruits due to the complete conversion of lycopene to beta-carotene.Unexpectedly, Lcy-b expression in transgenic fruits was also developmentally regulated, despite the fact that the gene was driven by a constitutive promoter.Our data provide evidence that in photosynthetic cells a strict and aspecific mechanism controls the level of transcripts until the onset of chromoplasts differentiation, at which point a gene-specific control on transcription takes place.

View Article: PubMed Central - PubMed

Affiliation: Metapontum Agrobios, S.S. Jonica 106, Km 448.2, Metaponto, MT , 75010, Italy. ggiorio@agrobios.it

ABSTRACT
Genetic manipulation of carotenoid biosynthesis in higher plants has been the objective of a number of biotechnology programs, e.g. the Golden Rice Program. However, tomato (Solanum lycopersicum L.), which naturally accumulates lycopene in fruits, has attracted the attention of many groups who have manipulated it to increase or diversify carotenoid accumulation. One of the most significant achievements was "HighCaro (HC)," a transgenic tomato plant constitutively expressing the tomato lycopene beta-cyclase (tLcy-b), that produces orange fruits due to the complete conversion of lycopene to beta-carotene. In this article we report the results of a field trial conducted in Metaponto (Italy) on HC and on two control genotypes to evaluate the stability of the transgenic trait and their yield performances. Transcriptional regulation of eight genes involved in carotenogenesis was assayed by quantitative real-time PCR (qRT-PCR) analysis on fruits collected at four distinct development stages. Statistical analysis results demonstrated that in field conditions the transgene maintained its ability to induce the conversion of lycopene to beta-carotene. Moreover, agronomic performances and fruit quality in the transgenic line were not impaired by this metabolic disturbance. Results of qRT-PCR analysis suggested that transcription of PSY-1, PDS and ZDS genes were developmentally regulated in both genotypes. Unexpectedly, Lcy-b expression in transgenic fruits was also developmentally regulated, despite the fact that the gene was driven by a constitutive promoter. Our data provide evidence that in photosynthetic cells a strict and aspecific mechanism controls the level of transcripts until the onset of chromoplasts differentiation, at which point a gene-specific control on transcription takes place.

Show MeSH
Related in: MedlinePlus