Limits...
Structures of the Shigella flexneri type 3 secretion system protein MxiC reveal conformational variability amongst homologues.

Deane JE, Roversi P, King C, Johnson S, Lea SM - J. Mol. Biol. (2008)

Bottom Line: This negative regulation is mediated, in part, by a family of proteins that are thought to physically block the entrance to the secretion apparatus until an appropriate signal is received following host cell contact.Interestingly, comparison of the Shigella and Yersinia structures reveals a significant structural change that results in substantial domain re-arrangement and opening of one face of the molecule.The conservation of a negatively charged patch on this face suggests it may have a role in binding other components of the T3SS.

View Article: PubMed Central - PubMed

Affiliation: Sir William Dunn School of Pathology, South Parks Rd, University of Oxford, Oxford OX1 3RE, UK.

ABSTRACT
Many Gram-negative pathogenic bacteria use a complex macromolecular machine, known as the type 3 secretion system (T3SS), to transfer virulence proteins into host cells. The T3SS is composed of a cytoplasmic bulb, a basal body spanning the inner and outer bacterial membranes, and an extracellular needle. Secretion is regulated by both cytoplasmic and inner membrane proteins that must respond to specific signals in order to ensure that virulence proteins are not secreted before contact with a eukaryotic cell. This negative regulation is mediated, in part, by a family of proteins that are thought to physically block the entrance to the secretion apparatus until an appropriate signal is received following host cell contact. Despite weak sequence homology between proteins of this family, the crystal structures of Shigella flexneri MxiC we present here confirm the conservation of domain topology with the homologue from Yersinia sp. Interestingly, comparison of the Shigella and Yersinia structures reveals a significant structural change that results in substantial domain re-arrangement and opening of one face of the molecule. The conservation of a negatively charged patch on this face suggests it may have a role in binding other components of the T3SS.

Show MeSH

Related in: MedlinePlus

Size-exclusion chromatography and limited proteolysis of MxiC. a, Elution of MxiCFL (continuous line) and MxiCNΔ73 (broken line) from a HiLoad 16/60 Superdex 200 column pre-equilibrated in 20 mM Tris (pH 7.5), 150 mM NaCl. MxiCFL and MxiCNΔ73 elute as monomers as single, slightly asymmetric peaks. b, SDS-PAGE of limited proteolysis of MxiCFL. Degradation of purified MxiCFL was considerable after storage at 4 °C for eight weeks (lane 1). Limited proteolysis was carried out on freshly purified MxiCFL incubated for 2 h at 20 °C with an increasing mass ratio of protein:subtilisin from 20 μg:2 ng to 20 μg:80 ng (lanes 2–6). Methods: DNA fragments of the mxiC gene encoding residues 1–355 (full length, MxiCFL) and 74–355 (N-terminal truncation, MxiCNΔ73) were produced by PCR (FLf, CATATGCTTGATGTTAAAAATACAGGAGTTTTT; N73f, CATATGAGTCAGGAACGTATTTTAGAT; FLr, GAATTCTTATCTAGAAAGCTCTTTCTTGTATGCACT) and cloned into the NdeI-EcoRI sites of the pET28b vector. These constructs include an N-terminal His6-tag and a thrombin cleavage site. MxiC constructs were expressed in Escherichia coli BL21 (DE3) cells grown in LB medium containing 34 μg ml− 1 kanamycin. Cells were grown at 37 °C until an A600 nm of ∼ 0.6 was reached, whereupon they were cooled to 20 °C and protein over-expression was induced by the addition of IPTG (1.0 mM final concentration). After ∼ 16 h, cells were harvested by centrifugation (15 min, 5000g, 4 °C) and pellets were frozen at – 80 °C. Cell pellets were resuspended in lysis buffer (20 mM Tris (pH 7.5), 500 mM NaCl and Complete EDTA-free Protease Inhibitor Cocktail, Roche) and lysed using an Emulsiflex-C5 Homogeniser (Glen Creston, UK). The resultant cell suspension was centrifuged (20 min, 20,000g, 4 °C) and the soluble fraction was applied to a pre-charged HisTrap FF nickel affinity column (GE Life Sciences). Protein was eluted using a gradient of 0–1 M imidazole in 20 mM Tris (pH 7.5), 500 mM NaCl and fractions containing MxiC were further purified by size-exclusion chromatography as described above. SDS-PAGE analysis revealed MxiCFL and MxiCNΔ73 to be pure (data not shown). Fractions containing purified MxiC were pooled and concentrated using Millipore Ultra-15 10 k MWCO centrifugal filtration devices to 7 mg ml− 1 and stored at 4 °C. Selenomethionine (SeMet)-labeled MxiC was produced by expression in the E.coli met− auxotrophic strain B834 (DE3). Cultures were grown in LB medium to an A600 nm of 0.9 then pelleted (15 min, 4000g, 4 °C) and washed in PBS three times before being used to inoculate SelenoMet Medium Base™ containing SelenoMet Nutrient Mix™ (Molecular Dimensions). Cells were grown and induced as described above. SeMet-labeled protein was purified as described above. Full incorporation of selenomethionine was confirmed by mass spectrometry. Dynamic light-scattering experiments were performed on a Viscotek model 802 DLS instrument using the OmniSIZE 2.0 acquisition and control software according to the manufacturer's instructions at 20 °C on a 1 mg ml− 1 protein sample in 20 mM Tris (pH 7.5), 150 mM NaCl.
© Copyright Policy
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC2724173&req=5

fig1: Size-exclusion chromatography and limited proteolysis of MxiC. a, Elution of MxiCFL (continuous line) and MxiCNΔ73 (broken line) from a HiLoad 16/60 Superdex 200 column pre-equilibrated in 20 mM Tris (pH 7.5), 150 mM NaCl. MxiCFL and MxiCNΔ73 elute as monomers as single, slightly asymmetric peaks. b, SDS-PAGE of limited proteolysis of MxiCFL. Degradation of purified MxiCFL was considerable after storage at 4 °C for eight weeks (lane 1). Limited proteolysis was carried out on freshly purified MxiCFL incubated for 2 h at 20 °C with an increasing mass ratio of protein:subtilisin from 20 μg:2 ng to 20 μg:80 ng (lanes 2–6). Methods: DNA fragments of the mxiC gene encoding residues 1–355 (full length, MxiCFL) and 74–355 (N-terminal truncation, MxiCNΔ73) were produced by PCR (FLf, CATATGCTTGATGTTAAAAATACAGGAGTTTTT; N73f, CATATGAGTCAGGAACGTATTTTAGAT; FLr, GAATTCTTATCTAGAAAGCTCTTTCTTGTATGCACT) and cloned into the NdeI-EcoRI sites of the pET28b vector. These constructs include an N-terminal His6-tag and a thrombin cleavage site. MxiC constructs were expressed in Escherichia coli BL21 (DE3) cells grown in LB medium containing 34 μg ml− 1 kanamycin. Cells were grown at 37 °C until an A600 nm of ∼ 0.6 was reached, whereupon they were cooled to 20 °C and protein over-expression was induced by the addition of IPTG (1.0 mM final concentration). After ∼ 16 h, cells were harvested by centrifugation (15 min, 5000g, 4 °C) and pellets were frozen at – 80 °C. Cell pellets were resuspended in lysis buffer (20 mM Tris (pH 7.5), 500 mM NaCl and Complete EDTA-free Protease Inhibitor Cocktail, Roche) and lysed using an Emulsiflex-C5 Homogeniser (Glen Creston, UK). The resultant cell suspension was centrifuged (20 min, 20,000g, 4 °C) and the soluble fraction was applied to a pre-charged HisTrap FF nickel affinity column (GE Life Sciences). Protein was eluted using a gradient of 0–1 M imidazole in 20 mM Tris (pH 7.5), 500 mM NaCl and fractions containing MxiC were further purified by size-exclusion chromatography as described above. SDS-PAGE analysis revealed MxiCFL and MxiCNΔ73 to be pure (data not shown). Fractions containing purified MxiC were pooled and concentrated using Millipore Ultra-15 10 k MWCO centrifugal filtration devices to 7 mg ml− 1 and stored at 4 °C. Selenomethionine (SeMet)-labeled MxiC was produced by expression in the E.coli met− auxotrophic strain B834 (DE3). Cultures were grown in LB medium to an A600 nm of 0.9 then pelleted (15 min, 4000g, 4 °C) and washed in PBS three times before being used to inoculate SelenoMet Medium Base™ containing SelenoMet Nutrient Mix™ (Molecular Dimensions). Cells were grown and induced as described above. SeMet-labeled protein was purified as described above. Full incorporation of selenomethionine was confirmed by mass spectrometry. Dynamic light-scattering experiments were performed on a Viscotek model 802 DLS instrument using the OmniSIZE 2.0 acquisition and control software according to the manufacturer's instructions at 20 °C on a 1 mg ml− 1 protein sample in 20 mM Tris (pH 7.5), 150 mM NaCl.

Mentions: A full-length construct of MxiC (residues 1–355, MxiCFL) was purified by nickel-affinity chromatography followed by size-exclusion chromatography and revealed that MxiCFL elutes at a volume less than that of a monomer, but greater than that of a dimer (Fig. 1a). This result, combined with dynamic light-scattering data that revealed a major species with a larger than expected hydrodynamic radius (Rh ∼ 3.8 nm), suggested that MxiCFL does not possess a globular structure and may possess an elongated fold and/or be partially disordered. In crystallization trials, MxiCFL initially yielded three different crystal forms (two distinct P21 and one P43212) that diffracted only to 3.5–3.9 Å resolution. Selenomethionine-labeled MxiCFL yielded crystals (P43212 with a different cell) that diffracted to 3.2 Å resolution and were used for phasing by the multiple-wavelength anomalous diffraction (MAD) method (Table 1). Preliminary model building into these maps revealed that the first 70–80 residues were poorly ordered and not visible in the electron density. In addition, we observed that, in solution, the N terminus was susceptible to proteolytic degradation (Fig. 1b). Limited proteolysis with subtilisin followed by N-terminal sequencing and mass spectrometry revealed several degradation products resulting from cleavage of the N terminus up to residue 64. This proteolytically sensitive region of MxiC is equivalent to the region of YopN (32–76) that was shown to bind its chaperone and was disordered in the absence of this chaperone.5 Furthermore, in vivo, the stable expression and efficient secretion of YopN requires its chaperone.18 The proteolytic susceptibility of the N-terminal region of MxiC suggests that chaperone binding may act to protect MxiC from degradation via a similar mechanism. To date, a chaperone for MxiC has not been identified. In order to improve the quality of MxiC crystals, a shortened construct encompassing residues 74–355 (MxiCNΔ73) was expressed, purified (Fig. 1a) and subjected to crystallization trials.


Structures of the Shigella flexneri type 3 secretion system protein MxiC reveal conformational variability amongst homologues.

Deane JE, Roversi P, King C, Johnson S, Lea SM - J. Mol. Biol. (2008)

Size-exclusion chromatography and limited proteolysis of MxiC. a, Elution of MxiCFL (continuous line) and MxiCNΔ73 (broken line) from a HiLoad 16/60 Superdex 200 column pre-equilibrated in 20 mM Tris (pH 7.5), 150 mM NaCl. MxiCFL and MxiCNΔ73 elute as monomers as single, slightly asymmetric peaks. b, SDS-PAGE of limited proteolysis of MxiCFL. Degradation of purified MxiCFL was considerable after storage at 4 °C for eight weeks (lane 1). Limited proteolysis was carried out on freshly purified MxiCFL incubated for 2 h at 20 °C with an increasing mass ratio of protein:subtilisin from 20 μg:2 ng to 20 μg:80 ng (lanes 2–6). Methods: DNA fragments of the mxiC gene encoding residues 1–355 (full length, MxiCFL) and 74–355 (N-terminal truncation, MxiCNΔ73) were produced by PCR (FLf, CATATGCTTGATGTTAAAAATACAGGAGTTTTT; N73f, CATATGAGTCAGGAACGTATTTTAGAT; FLr, GAATTCTTATCTAGAAAGCTCTTTCTTGTATGCACT) and cloned into the NdeI-EcoRI sites of the pET28b vector. These constructs include an N-terminal His6-tag and a thrombin cleavage site. MxiC constructs were expressed in Escherichia coli BL21 (DE3) cells grown in LB medium containing 34 μg ml− 1 kanamycin. Cells were grown at 37 °C until an A600 nm of ∼ 0.6 was reached, whereupon they were cooled to 20 °C and protein over-expression was induced by the addition of IPTG (1.0 mM final concentration). After ∼ 16 h, cells were harvested by centrifugation (15 min, 5000g, 4 °C) and pellets were frozen at – 80 °C. Cell pellets were resuspended in lysis buffer (20 mM Tris (pH 7.5), 500 mM NaCl and Complete EDTA-free Protease Inhibitor Cocktail, Roche) and lysed using an Emulsiflex-C5 Homogeniser (Glen Creston, UK). The resultant cell suspension was centrifuged (20 min, 20,000g, 4 °C) and the soluble fraction was applied to a pre-charged HisTrap FF nickel affinity column (GE Life Sciences). Protein was eluted using a gradient of 0–1 M imidazole in 20 mM Tris (pH 7.5), 500 mM NaCl and fractions containing MxiC were further purified by size-exclusion chromatography as described above. SDS-PAGE analysis revealed MxiCFL and MxiCNΔ73 to be pure (data not shown). Fractions containing purified MxiC were pooled and concentrated using Millipore Ultra-15 10 k MWCO centrifugal filtration devices to 7 mg ml− 1 and stored at 4 °C. Selenomethionine (SeMet)-labeled MxiC was produced by expression in the E.coli met− auxotrophic strain B834 (DE3). Cultures were grown in LB medium to an A600 nm of 0.9 then pelleted (15 min, 4000g, 4 °C) and washed in PBS three times before being used to inoculate SelenoMet Medium Base™ containing SelenoMet Nutrient Mix™ (Molecular Dimensions). Cells were grown and induced as described above. SeMet-labeled protein was purified as described above. Full incorporation of selenomethionine was confirmed by mass spectrometry. Dynamic light-scattering experiments were performed on a Viscotek model 802 DLS instrument using the OmniSIZE 2.0 acquisition and control software according to the manufacturer's instructions at 20 °C on a 1 mg ml− 1 protein sample in 20 mM Tris (pH 7.5), 150 mM NaCl.
© Copyright Policy
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC2724173&req=5

fig1: Size-exclusion chromatography and limited proteolysis of MxiC. a, Elution of MxiCFL (continuous line) and MxiCNΔ73 (broken line) from a HiLoad 16/60 Superdex 200 column pre-equilibrated in 20 mM Tris (pH 7.5), 150 mM NaCl. MxiCFL and MxiCNΔ73 elute as monomers as single, slightly asymmetric peaks. b, SDS-PAGE of limited proteolysis of MxiCFL. Degradation of purified MxiCFL was considerable after storage at 4 °C for eight weeks (lane 1). Limited proteolysis was carried out on freshly purified MxiCFL incubated for 2 h at 20 °C with an increasing mass ratio of protein:subtilisin from 20 μg:2 ng to 20 μg:80 ng (lanes 2–6). Methods: DNA fragments of the mxiC gene encoding residues 1–355 (full length, MxiCFL) and 74–355 (N-terminal truncation, MxiCNΔ73) were produced by PCR (FLf, CATATGCTTGATGTTAAAAATACAGGAGTTTTT; N73f, CATATGAGTCAGGAACGTATTTTAGAT; FLr, GAATTCTTATCTAGAAAGCTCTTTCTTGTATGCACT) and cloned into the NdeI-EcoRI sites of the pET28b vector. These constructs include an N-terminal His6-tag and a thrombin cleavage site. MxiC constructs were expressed in Escherichia coli BL21 (DE3) cells grown in LB medium containing 34 μg ml− 1 kanamycin. Cells were grown at 37 °C until an A600 nm of ∼ 0.6 was reached, whereupon they were cooled to 20 °C and protein over-expression was induced by the addition of IPTG (1.0 mM final concentration). After ∼ 16 h, cells were harvested by centrifugation (15 min, 5000g, 4 °C) and pellets were frozen at – 80 °C. Cell pellets were resuspended in lysis buffer (20 mM Tris (pH 7.5), 500 mM NaCl and Complete EDTA-free Protease Inhibitor Cocktail, Roche) and lysed using an Emulsiflex-C5 Homogeniser (Glen Creston, UK). The resultant cell suspension was centrifuged (20 min, 20,000g, 4 °C) and the soluble fraction was applied to a pre-charged HisTrap FF nickel affinity column (GE Life Sciences). Protein was eluted using a gradient of 0–1 M imidazole in 20 mM Tris (pH 7.5), 500 mM NaCl and fractions containing MxiC were further purified by size-exclusion chromatography as described above. SDS-PAGE analysis revealed MxiCFL and MxiCNΔ73 to be pure (data not shown). Fractions containing purified MxiC were pooled and concentrated using Millipore Ultra-15 10 k MWCO centrifugal filtration devices to 7 mg ml− 1 and stored at 4 °C. Selenomethionine (SeMet)-labeled MxiC was produced by expression in the E.coli met− auxotrophic strain B834 (DE3). Cultures were grown in LB medium to an A600 nm of 0.9 then pelleted (15 min, 4000g, 4 °C) and washed in PBS three times before being used to inoculate SelenoMet Medium Base™ containing SelenoMet Nutrient Mix™ (Molecular Dimensions). Cells were grown and induced as described above. SeMet-labeled protein was purified as described above. Full incorporation of selenomethionine was confirmed by mass spectrometry. Dynamic light-scattering experiments were performed on a Viscotek model 802 DLS instrument using the OmniSIZE 2.0 acquisition and control software according to the manufacturer's instructions at 20 °C on a 1 mg ml− 1 protein sample in 20 mM Tris (pH 7.5), 150 mM NaCl.
Mentions: A full-length construct of MxiC (residues 1–355, MxiCFL) was purified by nickel-affinity chromatography followed by size-exclusion chromatography and revealed that MxiCFL elutes at a volume less than that of a monomer, but greater than that of a dimer (Fig. 1a). This result, combined with dynamic light-scattering data that revealed a major species with a larger than expected hydrodynamic radius (Rh ∼ 3.8 nm), suggested that MxiCFL does not possess a globular structure and may possess an elongated fold and/or be partially disordered. In crystallization trials, MxiCFL initially yielded three different crystal forms (two distinct P21 and one P43212) that diffracted only to 3.5–3.9 Å resolution. Selenomethionine-labeled MxiCFL yielded crystals (P43212 with a different cell) that diffracted to 3.2 Å resolution and were used for phasing by the multiple-wavelength anomalous diffraction (MAD) method (Table 1). Preliminary model building into these maps revealed that the first 70–80 residues were poorly ordered and not visible in the electron density. In addition, we observed that, in solution, the N terminus was susceptible to proteolytic degradation (Fig. 1b). Limited proteolysis with subtilisin followed by N-terminal sequencing and mass spectrometry revealed several degradation products resulting from cleavage of the N terminus up to residue 64. This proteolytically sensitive region of MxiC is equivalent to the region of YopN (32–76) that was shown to bind its chaperone and was disordered in the absence of this chaperone.5 Furthermore, in vivo, the stable expression and efficient secretion of YopN requires its chaperone.18 The proteolytic susceptibility of the N-terminal region of MxiC suggests that chaperone binding may act to protect MxiC from degradation via a similar mechanism. To date, a chaperone for MxiC has not been identified. In order to improve the quality of MxiC crystals, a shortened construct encompassing residues 74–355 (MxiCNΔ73) was expressed, purified (Fig. 1a) and subjected to crystallization trials.

Bottom Line: This negative regulation is mediated, in part, by a family of proteins that are thought to physically block the entrance to the secretion apparatus until an appropriate signal is received following host cell contact.Interestingly, comparison of the Shigella and Yersinia structures reveals a significant structural change that results in substantial domain re-arrangement and opening of one face of the molecule.The conservation of a negatively charged patch on this face suggests it may have a role in binding other components of the T3SS.

View Article: PubMed Central - PubMed

Affiliation: Sir William Dunn School of Pathology, South Parks Rd, University of Oxford, Oxford OX1 3RE, UK.

ABSTRACT
Many Gram-negative pathogenic bacteria use a complex macromolecular machine, known as the type 3 secretion system (T3SS), to transfer virulence proteins into host cells. The T3SS is composed of a cytoplasmic bulb, a basal body spanning the inner and outer bacterial membranes, and an extracellular needle. Secretion is regulated by both cytoplasmic and inner membrane proteins that must respond to specific signals in order to ensure that virulence proteins are not secreted before contact with a eukaryotic cell. This negative regulation is mediated, in part, by a family of proteins that are thought to physically block the entrance to the secretion apparatus until an appropriate signal is received following host cell contact. Despite weak sequence homology between proteins of this family, the crystal structures of Shigella flexneri MxiC we present here confirm the conservation of domain topology with the homologue from Yersinia sp. Interestingly, comparison of the Shigella and Yersinia structures reveals a significant structural change that results in substantial domain re-arrangement and opening of one face of the molecule. The conservation of a negatively charged patch on this face suggests it may have a role in binding other components of the T3SS.

Show MeSH
Related in: MedlinePlus