Limits...
Probing the functional impact of sequence variation on p53-DNA interactions using a novel microsphere assay for protein-DNA binding with human cell extracts.

Noureddine MA, Menendez D, Campbell MR, Bandele OJ, Horvath MM, Wang X, Pittman GS, Chorley BN, Resnick MA, Bell DA - PLoS Genet. (2009)

Bottom Line: Using MAPD we measured sequence-specific p53 binding of doxorubicin-activated or transiently expressed p53 to REs from established p53 target genes and p53 consensus REs.A group of eight single nucleotide polymorphisms (SNPs) was examined and binding profiles closely matched transactivation capability tested in luciferase constructs.Using a set of 26 bona fide REs, we observed distinct binding patterns characteristic of transiently expressed wild type and mutant p53s.

View Article: PubMed Central - PubMed

Affiliation: Environmental Genomics Group, Laboratory of Molecular Genetics, National Institute of Environmental Health Sciences, NIH, Research Triangle Park, NC, USA.

ABSTRACT
The p53 tumor suppressor regulates its target genes through sequence-specific binding to DNA response elements (REs). Although numerous p53 REs are established, the thousands more identified by bioinformatics are not easily subjected to comparative functional evaluation. To examine the relationship between RE sequence variation -- including polymorphisms -- and p53 binding, we have developed a multiplex format microsphere assay of protein-DNA binding (MAPD) for p53 in nuclear extracts. Using MAPD we measured sequence-specific p53 binding of doxorubicin-activated or transiently expressed p53 to REs from established p53 target genes and p53 consensus REs. To assess the sensitivity and scalability of the assay, we tested 16 variants of the p21 target sequence and a 62-multiplex set of single nucleotide (nt) variants of the p53 consensus sequence and found many changes in p53 binding that are not captured by current computational binding models. A group of eight single nucleotide polymorphisms (SNPs) was examined and binding profiles closely matched transactivation capability tested in luciferase constructs. The in vitro binding characteristics of p53 in nuclear extracts recapitulated the cellular in vivo transactivation capabilities for eight well-established human REs measured by luciferase assay. Using a set of 26 bona fide REs, we observed distinct binding patterns characteristic of transiently expressed wild type and mutant p53s. This microsphere assay system utilizes biologically meaningful cell extracts in a multiplexed, quantitative, in vitro format that provides a powerful experimental tool for elucidating the functional impact of sequence polymorphism and protein variation on protein/DNA binding in transcriptional networks.

Show MeSH

Related in: MedlinePlus

Sequence variation affects p53 binding.A) Evaluating the impact of single nucleotide variations in p21 RE on p53 binding using nuclear extracts from untreated and DOXO-treated cells. A set of 19 oligonucleotides, each conjugated to a unique bead, were multiplexed and treated with 1.75 µg of non-treated nuclear extracts (NT: checkered bar) or activated nuclear extracts (black bar: DOXO-treated lymphoblastoid cells). Relative binding intensity is shown on the horizontal axis (note the break in the scale to accommodate the signal from all oligonucleotides). Relative binding values were obtained for each oligonucleotide as discussed in Materials and Methods. The oligonucleotide bearing the p53 consensus sequence (ConA) is first on the list (top left Y-axis) followed by wild type p21RE (p21LWT). p21GL3 bears the same 20-nt RE as p21LWT but with a synthetic backbone sequence from pGL3 vector. Fifteen single or double variants of p21 RE are shown. The p21 sequence is shown as inset. The number denotes the numerical position of the base within the p21 RE. Arrowheads point to the nts that have been chosen for alteration. WRNC is a negative control oligonucleotide and carries a nonbinding sequence in the same backbone as the other oligonucleotides shown with the exception of P21GL3. Values shown are the mean+/−SD (n = 3). B) Multiplex binding measurements of 60 variants of a p53 consensus sequence. Sixty oligonucleotides, each bearing a single nucleotide variation of the p53 consensus binding site (ConA = GGGCATGTCCGGGCATGTCC) were generated. ConA sequence is shown in large letters under arrow. CATG core of each half-site is shown in a right-facing bracket. Systematic base substitutions at all positions within ConA are shown in small letters. For instance, 1G>C is an RE with the first G converted to a C. In addition, a positive control bead (ConA RE) and a negative control bead (WRNC: lacks a p53 binding RE) were included. Equal amounts of each microsphere type were mixed to generate a multiplex of 62 bead types. Following treatment with activated nuclear extracts (DOXO-treated or untreated lymphoblastoid cells, Figure S3), the relative binding intensity (value shown on upper horizontal axis) was obtained for each oligonucleotide (white bar) as discussed in Materials and Methods. Bar values are means for each bead type+/−SD (n = 3). The black bar graph in the background (e.g. black bars) shows the calculated PWM value for each variant oligonucleotide tested (scale depicted on the lower horizontal axis). A list of PWM values for REs used can be found in Supporting Information.
© Copyright Policy
Related In: Results  -  Collection


getmorefigures.php?uid=PMC2667269&req=5

pgen-1000462-g003: Sequence variation affects p53 binding.A) Evaluating the impact of single nucleotide variations in p21 RE on p53 binding using nuclear extracts from untreated and DOXO-treated cells. A set of 19 oligonucleotides, each conjugated to a unique bead, were multiplexed and treated with 1.75 µg of non-treated nuclear extracts (NT: checkered bar) or activated nuclear extracts (black bar: DOXO-treated lymphoblastoid cells). Relative binding intensity is shown on the horizontal axis (note the break in the scale to accommodate the signal from all oligonucleotides). Relative binding values were obtained for each oligonucleotide as discussed in Materials and Methods. The oligonucleotide bearing the p53 consensus sequence (ConA) is first on the list (top left Y-axis) followed by wild type p21RE (p21LWT). p21GL3 bears the same 20-nt RE as p21LWT but with a synthetic backbone sequence from pGL3 vector. Fifteen single or double variants of p21 RE are shown. The p21 sequence is shown as inset. The number denotes the numerical position of the base within the p21 RE. Arrowheads point to the nts that have been chosen for alteration. WRNC is a negative control oligonucleotide and carries a nonbinding sequence in the same backbone as the other oligonucleotides shown with the exception of P21GL3. Values shown are the mean+/−SD (n = 3). B) Multiplex binding measurements of 60 variants of a p53 consensus sequence. Sixty oligonucleotides, each bearing a single nucleotide variation of the p53 consensus binding site (ConA = GGGCATGTCCGGGCATGTCC) were generated. ConA sequence is shown in large letters under arrow. CATG core of each half-site is shown in a right-facing bracket. Systematic base substitutions at all positions within ConA are shown in small letters. For instance, 1G>C is an RE with the first G converted to a C. In addition, a positive control bead (ConA RE) and a negative control bead (WRNC: lacks a p53 binding RE) were included. Equal amounts of each microsphere type were mixed to generate a multiplex of 62 bead types. Following treatment with activated nuclear extracts (DOXO-treated or untreated lymphoblastoid cells, Figure S3), the relative binding intensity (value shown on upper horizontal axis) was obtained for each oligonucleotide (white bar) as discussed in Materials and Methods. Bar values are means for each bead type+/−SD (n = 3). The black bar graph in the background (e.g. black bars) shows the calculated PWM value for each variant oligonucleotide tested (scale depicted on the lower horizontal axis). A list of PWM values for REs used can be found in Supporting Information.

Mentions: MAPD is highly suited to experiments such as site-directed mutagenesis of REs or SNP functional analysis, as shown in Figure 3A for p53 RE of p21, designated p21LWT. To investigate the importance of individual nucleotides on p53 binding, NT and DOXO-treated cell nuclear extracts were hybridized with 16 variants of the p21 RE in a 19-plex reaction that included two positive controls (ConA and p21LWT) and a negative control (WRNC). DOXO-treated cell extracts produced higher binding for all sequences. The p21 RE produced strong binding signals relative to WRNC, both when embedded in its native flanking sequence (p21LWT 0.62+/−0.021) or an unrelated flanking sequence (p21GL3 0.58+/−0.021; sequences are listed in Supporting Information). The perfect consensus p53 RE, ConA, showed a stronger signal (1.21+/−0.083) relative to p21LWT. Changing the p21LWT sequence at nt-11 from C to G (Figure 3A 11C>G), a change favoring consensus, resulted in binding that was slightly higher (0.64+/−0.038) than the native p21LWT. Moreover, when positions nt-11 and nt-20 in p21LWT were simultaneously changed to better match the consensus (Figure 3A, 11C>G; 20G>C), there was a 29% increase in p53 binding (from 0.64 to 0.83+/−0.069). This provides an example of how sequence variation has the potential to increase transcription factor binding. Among mammalian p53 REs, the most conserved positions are C and G nucleotides 4, 7, 14, and 17, and many studies have observed that changes at these positions strongly impact p53 transactivation [3],[4],[5],[6],[27],[28],[29]. The present data demonstrate that these effects are due to decreased p53 binding.


Probing the functional impact of sequence variation on p53-DNA interactions using a novel microsphere assay for protein-DNA binding with human cell extracts.

Noureddine MA, Menendez D, Campbell MR, Bandele OJ, Horvath MM, Wang X, Pittman GS, Chorley BN, Resnick MA, Bell DA - PLoS Genet. (2009)

Sequence variation affects p53 binding.A) Evaluating the impact of single nucleotide variations in p21 RE on p53 binding using nuclear extracts from untreated and DOXO-treated cells. A set of 19 oligonucleotides, each conjugated to a unique bead, were multiplexed and treated with 1.75 µg of non-treated nuclear extracts (NT: checkered bar) or activated nuclear extracts (black bar: DOXO-treated lymphoblastoid cells). Relative binding intensity is shown on the horizontal axis (note the break in the scale to accommodate the signal from all oligonucleotides). Relative binding values were obtained for each oligonucleotide as discussed in Materials and Methods. The oligonucleotide bearing the p53 consensus sequence (ConA) is first on the list (top left Y-axis) followed by wild type p21RE (p21LWT). p21GL3 bears the same 20-nt RE as p21LWT but with a synthetic backbone sequence from pGL3 vector. Fifteen single or double variants of p21 RE are shown. The p21 sequence is shown as inset. The number denotes the numerical position of the base within the p21 RE. Arrowheads point to the nts that have been chosen for alteration. WRNC is a negative control oligonucleotide and carries a nonbinding sequence in the same backbone as the other oligonucleotides shown with the exception of P21GL3. Values shown are the mean+/−SD (n = 3). B) Multiplex binding measurements of 60 variants of a p53 consensus sequence. Sixty oligonucleotides, each bearing a single nucleotide variation of the p53 consensus binding site (ConA = GGGCATGTCCGGGCATGTCC) were generated. ConA sequence is shown in large letters under arrow. CATG core of each half-site is shown in a right-facing bracket. Systematic base substitutions at all positions within ConA are shown in small letters. For instance, 1G>C is an RE with the first G converted to a C. In addition, a positive control bead (ConA RE) and a negative control bead (WRNC: lacks a p53 binding RE) were included. Equal amounts of each microsphere type were mixed to generate a multiplex of 62 bead types. Following treatment with activated nuclear extracts (DOXO-treated or untreated lymphoblastoid cells, Figure S3), the relative binding intensity (value shown on upper horizontal axis) was obtained for each oligonucleotide (white bar) as discussed in Materials and Methods. Bar values are means for each bead type+/−SD (n = 3). The black bar graph in the background (e.g. black bars) shows the calculated PWM value for each variant oligonucleotide tested (scale depicted on the lower horizontal axis). A list of PWM values for REs used can be found in Supporting Information.
© Copyright Policy
Related In: Results  -  Collection

Show All Figures
getmorefigures.php?uid=PMC2667269&req=5

pgen-1000462-g003: Sequence variation affects p53 binding.A) Evaluating the impact of single nucleotide variations in p21 RE on p53 binding using nuclear extracts from untreated and DOXO-treated cells. A set of 19 oligonucleotides, each conjugated to a unique bead, were multiplexed and treated with 1.75 µg of non-treated nuclear extracts (NT: checkered bar) or activated nuclear extracts (black bar: DOXO-treated lymphoblastoid cells). Relative binding intensity is shown on the horizontal axis (note the break in the scale to accommodate the signal from all oligonucleotides). Relative binding values were obtained for each oligonucleotide as discussed in Materials and Methods. The oligonucleotide bearing the p53 consensus sequence (ConA) is first on the list (top left Y-axis) followed by wild type p21RE (p21LWT). p21GL3 bears the same 20-nt RE as p21LWT but with a synthetic backbone sequence from pGL3 vector. Fifteen single or double variants of p21 RE are shown. The p21 sequence is shown as inset. The number denotes the numerical position of the base within the p21 RE. Arrowheads point to the nts that have been chosen for alteration. WRNC is a negative control oligonucleotide and carries a nonbinding sequence in the same backbone as the other oligonucleotides shown with the exception of P21GL3. Values shown are the mean+/−SD (n = 3). B) Multiplex binding measurements of 60 variants of a p53 consensus sequence. Sixty oligonucleotides, each bearing a single nucleotide variation of the p53 consensus binding site (ConA = GGGCATGTCCGGGCATGTCC) were generated. ConA sequence is shown in large letters under arrow. CATG core of each half-site is shown in a right-facing bracket. Systematic base substitutions at all positions within ConA are shown in small letters. For instance, 1G>C is an RE with the first G converted to a C. In addition, a positive control bead (ConA RE) and a negative control bead (WRNC: lacks a p53 binding RE) were included. Equal amounts of each microsphere type were mixed to generate a multiplex of 62 bead types. Following treatment with activated nuclear extracts (DOXO-treated or untreated lymphoblastoid cells, Figure S3), the relative binding intensity (value shown on upper horizontal axis) was obtained for each oligonucleotide (white bar) as discussed in Materials and Methods. Bar values are means for each bead type+/−SD (n = 3). The black bar graph in the background (e.g. black bars) shows the calculated PWM value for each variant oligonucleotide tested (scale depicted on the lower horizontal axis). A list of PWM values for REs used can be found in Supporting Information.
Mentions: MAPD is highly suited to experiments such as site-directed mutagenesis of REs or SNP functional analysis, as shown in Figure 3A for p53 RE of p21, designated p21LWT. To investigate the importance of individual nucleotides on p53 binding, NT and DOXO-treated cell nuclear extracts were hybridized with 16 variants of the p21 RE in a 19-plex reaction that included two positive controls (ConA and p21LWT) and a negative control (WRNC). DOXO-treated cell extracts produced higher binding for all sequences. The p21 RE produced strong binding signals relative to WRNC, both when embedded in its native flanking sequence (p21LWT 0.62+/−0.021) or an unrelated flanking sequence (p21GL3 0.58+/−0.021; sequences are listed in Supporting Information). The perfect consensus p53 RE, ConA, showed a stronger signal (1.21+/−0.083) relative to p21LWT. Changing the p21LWT sequence at nt-11 from C to G (Figure 3A 11C>G), a change favoring consensus, resulted in binding that was slightly higher (0.64+/−0.038) than the native p21LWT. Moreover, when positions nt-11 and nt-20 in p21LWT were simultaneously changed to better match the consensus (Figure 3A, 11C>G; 20G>C), there was a 29% increase in p53 binding (from 0.64 to 0.83+/−0.069). This provides an example of how sequence variation has the potential to increase transcription factor binding. Among mammalian p53 REs, the most conserved positions are C and G nucleotides 4, 7, 14, and 17, and many studies have observed that changes at these positions strongly impact p53 transactivation [3],[4],[5],[6],[27],[28],[29]. The present data demonstrate that these effects are due to decreased p53 binding.

Bottom Line: Using MAPD we measured sequence-specific p53 binding of doxorubicin-activated or transiently expressed p53 to REs from established p53 target genes and p53 consensus REs.A group of eight single nucleotide polymorphisms (SNPs) was examined and binding profiles closely matched transactivation capability tested in luciferase constructs.Using a set of 26 bona fide REs, we observed distinct binding patterns characteristic of transiently expressed wild type and mutant p53s.

View Article: PubMed Central - PubMed

Affiliation: Environmental Genomics Group, Laboratory of Molecular Genetics, National Institute of Environmental Health Sciences, NIH, Research Triangle Park, NC, USA.

ABSTRACT
The p53 tumor suppressor regulates its target genes through sequence-specific binding to DNA response elements (REs). Although numerous p53 REs are established, the thousands more identified by bioinformatics are not easily subjected to comparative functional evaluation. To examine the relationship between RE sequence variation -- including polymorphisms -- and p53 binding, we have developed a multiplex format microsphere assay of protein-DNA binding (MAPD) for p53 in nuclear extracts. Using MAPD we measured sequence-specific p53 binding of doxorubicin-activated or transiently expressed p53 to REs from established p53 target genes and p53 consensus REs. To assess the sensitivity and scalability of the assay, we tested 16 variants of the p21 target sequence and a 62-multiplex set of single nucleotide (nt) variants of the p53 consensus sequence and found many changes in p53 binding that are not captured by current computational binding models. A group of eight single nucleotide polymorphisms (SNPs) was examined and binding profiles closely matched transactivation capability tested in luciferase constructs. The in vitro binding characteristics of p53 in nuclear extracts recapitulated the cellular in vivo transactivation capabilities for eight well-established human REs measured by luciferase assay. Using a set of 26 bona fide REs, we observed distinct binding patterns characteristic of transiently expressed wild type and mutant p53s. This microsphere assay system utilizes biologically meaningful cell extracts in a multiplexed, quantitative, in vitro format that provides a powerful experimental tool for elucidating the functional impact of sequence polymorphism and protein variation on protein/DNA binding in transcriptional networks.

Show MeSH
Related in: MedlinePlus