Limits...
Effects of CpG methylation on recognition of DNA by the tumour suppressor p53.

Petrovich M, Veprintsev DB - J. Mol. Biol. (2008)

Bottom Line: We found that binding of p53 was not affected by cytosine methylation in a majority of cases.However, for a few sequences containing multiple CpG dinucleotides, such as sites in the RB and Met genes, methylation resulted in a four- to sixfold increase in binding of p53.This approach can be used to quantify the effects of CpG methylation on the DNA recognition by other DNA-binding proteins.

View Article: PubMed Central - PubMed

Affiliation: MRC Centre for Protein Engineering, Cambridge CB2 0QH, UK.

ABSTRACT
Methylation of DNA is one of the mechanisms controlling the expression landscape of the genome. Its pattern is altered in cancer and often results in the hypermethylation of the promoter regions and abnormal expression of tumour suppressor genes. Methylation of CpG dinucleotides located in the binding sites of transcription factors may contribute to the development of cancers by preventing their binding or altering their specificity. We studied the effects of CpG methylation on DNA recognition by the tumour suppressor p53, a transcription factor involved in the response to carcinogenic stress. p53 recognises a large number of DNA sequences, many of which contain CpG dinucleotides. We systematically substituted a CpG dinucleotide at each position in the consensus p53 DNA binding sequence and identified substitutions tolerated by p53. We compared the binding affinities of methylated versus non-methylated sequences by fluorescence anisotropy titration. We found that binding of p53 was not affected by cytosine methylation in a majority of cases. However, for a few sequences containing multiple CpG dinucleotides, such as sites in the RB and Met genes, methylation resulted in a four- to sixfold increase in binding of p53. This approach can be used to quantify the effects of CpG methylation on the DNA recognition by other DNA-binding proteins.

Show MeSH

Related in: MedlinePlus

To access the whole variety of DNA sequences recognised by p53, we systematically introduced CpG or 5-methyl-CpG at every possible position in the sequence.
© Copyright Policy
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC2666794&req=5

fig1: To access the whole variety of DNA sequences recognised by p53, we systematically introduced CpG or 5-methyl-CpG at every possible position in the sequence.

Mentions: p53 recognises a large number of 20-bp DNA sequences consisting of two repeats of RRRCWWGYYY separated by 0–13 bp.15 Recent data suggest that this definition is too strict, and that p53 recognises a set of sequences that deviate from such a definition.16,20 A CpG dinucleotide may occupy any position within the p53 binding site. To address the potential impact of CpG methylation on the whole range of DNA sequences p53 recognises, we systematically substituted a CpG dinucleotide and a methylated CpG dinucleotide at each position in the consensus p53 DNA binding sequence. We chose a 26-bp sequence, CGCGGACATGTCCGGACATGTCCCGC, as a reference sequence. It consists of two identical copies of the GGACATGTCC half-site that is representative of a consensus sequence, RRRCWWGYYY, flanked by CGC triplets to improve the annealing properties of the oligonucleotide while minimising self-annealing. To assess the effect of methylation on both strands of DNA, we inserted methylated CpG on both strands (Fig. 1). Since the variation of the sequence affects the affinity, we used the identical unmethylated sequence as a control for each methylated sequence (Table 1).


Effects of CpG methylation on recognition of DNA by the tumour suppressor p53.

Petrovich M, Veprintsev DB - J. Mol. Biol. (2008)

To access the whole variety of DNA sequences recognised by p53, we systematically introduced CpG or 5-methyl-CpG at every possible position in the sequence.
© Copyright Policy
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC2666794&req=5

fig1: To access the whole variety of DNA sequences recognised by p53, we systematically introduced CpG or 5-methyl-CpG at every possible position in the sequence.
Mentions: p53 recognises a large number of 20-bp DNA sequences consisting of two repeats of RRRCWWGYYY separated by 0–13 bp.15 Recent data suggest that this definition is too strict, and that p53 recognises a set of sequences that deviate from such a definition.16,20 A CpG dinucleotide may occupy any position within the p53 binding site. To address the potential impact of CpG methylation on the whole range of DNA sequences p53 recognises, we systematically substituted a CpG dinucleotide and a methylated CpG dinucleotide at each position in the consensus p53 DNA binding sequence. We chose a 26-bp sequence, CGCGGACATGTCCGGACATGTCCCGC, as a reference sequence. It consists of two identical copies of the GGACATGTCC half-site that is representative of a consensus sequence, RRRCWWGYYY, flanked by CGC triplets to improve the annealing properties of the oligonucleotide while minimising self-annealing. To assess the effect of methylation on both strands of DNA, we inserted methylated CpG on both strands (Fig. 1). Since the variation of the sequence affects the affinity, we used the identical unmethylated sequence as a control for each methylated sequence (Table 1).

Bottom Line: We found that binding of p53 was not affected by cytosine methylation in a majority of cases.However, for a few sequences containing multiple CpG dinucleotides, such as sites in the RB and Met genes, methylation resulted in a four- to sixfold increase in binding of p53.This approach can be used to quantify the effects of CpG methylation on the DNA recognition by other DNA-binding proteins.

View Article: PubMed Central - PubMed

Affiliation: MRC Centre for Protein Engineering, Cambridge CB2 0QH, UK.

ABSTRACT
Methylation of DNA is one of the mechanisms controlling the expression landscape of the genome. Its pattern is altered in cancer and often results in the hypermethylation of the promoter regions and abnormal expression of tumour suppressor genes. Methylation of CpG dinucleotides located in the binding sites of transcription factors may contribute to the development of cancers by preventing their binding or altering their specificity. We studied the effects of CpG methylation on DNA recognition by the tumour suppressor p53, a transcription factor involved in the response to carcinogenic stress. p53 recognises a large number of DNA sequences, many of which contain CpG dinucleotides. We systematically substituted a CpG dinucleotide at each position in the consensus p53 DNA binding sequence and identified substitutions tolerated by p53. We compared the binding affinities of methylated versus non-methylated sequences by fluorescence anisotropy titration. We found that binding of p53 was not affected by cytosine methylation in a majority of cases. However, for a few sequences containing multiple CpG dinucleotides, such as sites in the RB and Met genes, methylation resulted in a four- to sixfold increase in binding of p53. This approach can be used to quantify the effects of CpG methylation on the DNA recognition by other DNA-binding proteins.

Show MeSH
Related in: MedlinePlus