Limits...
Circular dichroism and conformational polymorphism of DNA.

Kypr J, Kejnovská I, Renciuk D, Vorlícková M - Nucleic Acids Res. (2009)

Bottom Line: This fast and simple method can be used at low- as well as high-DNA concentrations and with short- as well as long-DNA molecules.The course of detected CD spectral changes makes possible to distinguish between gradual changes within a single DNA conformation and cooperative isomerizations between discrete structural states.It enables measuring kinetics of the appearance of particular conformers and determination of their thermodynamic parameters.

View Article: PubMed Central - PubMed

Affiliation: Institute of Biophysics, vvi Academy of Sciences of the Czech Republic, Brno, Czech Republic. kypr@ibp.cz

ABSTRACT
Here we review studies that provided important information about conformational properties of DNA using circular dichroic (CD) spectroscopy. The conformational properties include the B-family of structures, A-form, Z-form, guanine quadruplexes, cytosine quadruplexes, triplexes and other less characterized structures. CD spectroscopy is extremely sensitive and relatively inexpensive. This fast and simple method can be used at low- as well as high-DNA concentrations and with short- as well as long-DNA molecules. The samples can easily be titrated with various agents to cause conformational isomerizations of DNA. The course of detected CD spectral changes makes possible to distinguish between gradual changes within a single DNA conformation and cooperative isomerizations between discrete structural states. It enables measuring kinetics of the appearance of particular conformers and determination of their thermodynamic parameters. In careful hands, CD spectroscopy is a valuable tool for mapping conformational properties of particular DNA molecules. Due to its numerous advantages, CD spectroscopy significantly participated in all basic conformational findings on DNA.

Show MeSH
CD spectra of quadruplexes. Upper panels: CD spectra of guanine quadruplexes. (A) Time-dependent formation of a parallel-stranded quadruplex of d(G4) stabilized by 16 mM K+. (B) Na+-induced formation of an anti-parallel bimolecular quadruplex of d(G4T4G4). Both oligonucleotides were dissolved in 1 mM Na phosphate, 0.3 mM EDTA, pH 7 and thermally denatured (5 min at 90°C) and slowly cooled before starting measurements. The triangles in the sketches indicate guanines and point in the 5′–3′ direction. The G-tetrad is shown in the middle. Bottom panel: CD spectra reflecting the acid-induced transition of a DNA fragment d(TCCCCACCTTCCCCACCCTCCCCACCCTCCCCA) of a c-myc human oncogene into an intercalated cytosine quadruplex. The oligonucleotide was dissolved in Robinson–Britton buffer, pH 9.2 [24 mM (H3PO4 + H3BO3 + CH3COOH) + 82 mM NaOH]. The pH value was changed directly in the CD cell by addition of dilute HCl. The triangles in the sketch indicate cytosines and point in the 5′–3′ direction. The C+·C pair is shown in the insert.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC2665218&req=5

Figure 4: CD spectra of quadruplexes. Upper panels: CD spectra of guanine quadruplexes. (A) Time-dependent formation of a parallel-stranded quadruplex of d(G4) stabilized by 16 mM K+. (B) Na+-induced formation of an anti-parallel bimolecular quadruplex of d(G4T4G4). Both oligonucleotides were dissolved in 1 mM Na phosphate, 0.3 mM EDTA, pH 7 and thermally denatured (5 min at 90°C) and slowly cooled before starting measurements. The triangles in the sketches indicate guanines and point in the 5′–3′ direction. The G-tetrad is shown in the middle. Bottom panel: CD spectra reflecting the acid-induced transition of a DNA fragment d(TCCCCACCTTCCCCACCCTCCCCACCCTCCCCA) of a c-myc human oncogene into an intercalated cytosine quadruplex. The oligonucleotide was dissolved in Robinson–Britton buffer, pH 9.2 [24 mM (H3PO4 + H3BO3 + CH3COOH) + 82 mM NaOH]. The pH value was changed directly in the CD cell by addition of dilute HCl. The triangles in the sketch indicate cytosines and point in the 5′–3′ direction. The C+·C pair is shown in the insert.

Mentions: Guanine quadruplexes are of many types but all of them are based on guanine tetrads (Figure 4, upper panels). There are two basic types of the guanine quadruplexes. The spectra of parallel quadruplexes have a dominant positive band at 260 nm, whereas the spectra of anti-parallel quadruplexes have a negative band at 260 nm and positive band at 290 nm (Figure 4A and B, respectively) (12,42–45). Both quadruplex types display an additional characteristic positive peak at 210 nm. The different CD of the parallel and anti-parallel quadruplexes originates from different stacking interactions (12) of the guanosine residues distinctly oriented around their glycosidic bonds. Intermolecular guanine quadruplexes form slowly and also transitions between different quadruplex types are slow. Quadruplex formation is induced by physiologically relevant cations namely potassium, although ethanol is a still more effective inducer (46,47). The long-wavelength CD spectrum of a parallel quadruplex is similar to the CD spectrum of the A-form. This may suggest a similar base stacking in these two conformations (48,49). The quadruplex, however, has a positive band at 210 nm, whereas the A-form displays a deep negative one (compare Figures 4A and 3A).Figure 4.


Circular dichroism and conformational polymorphism of DNA.

Kypr J, Kejnovská I, Renciuk D, Vorlícková M - Nucleic Acids Res. (2009)

CD spectra of quadruplexes. Upper panels: CD spectra of guanine quadruplexes. (A) Time-dependent formation of a parallel-stranded quadruplex of d(G4) stabilized by 16 mM K+. (B) Na+-induced formation of an anti-parallel bimolecular quadruplex of d(G4T4G4). Both oligonucleotides were dissolved in 1 mM Na phosphate, 0.3 mM EDTA, pH 7 and thermally denatured (5 min at 90°C) and slowly cooled before starting measurements. The triangles in the sketches indicate guanines and point in the 5′–3′ direction. The G-tetrad is shown in the middle. Bottom panel: CD spectra reflecting the acid-induced transition of a DNA fragment d(TCCCCACCTTCCCCACCCTCCCCACCCTCCCCA) of a c-myc human oncogene into an intercalated cytosine quadruplex. The oligonucleotide was dissolved in Robinson–Britton buffer, pH 9.2 [24 mM (H3PO4 + H3BO3 + CH3COOH) + 82 mM NaOH]. The pH value was changed directly in the CD cell by addition of dilute HCl. The triangles in the sketch indicate cytosines and point in the 5′–3′ direction. The C+·C pair is shown in the insert.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC2665218&req=5

Figure 4: CD spectra of quadruplexes. Upper panels: CD spectra of guanine quadruplexes. (A) Time-dependent formation of a parallel-stranded quadruplex of d(G4) stabilized by 16 mM K+. (B) Na+-induced formation of an anti-parallel bimolecular quadruplex of d(G4T4G4). Both oligonucleotides were dissolved in 1 mM Na phosphate, 0.3 mM EDTA, pH 7 and thermally denatured (5 min at 90°C) and slowly cooled before starting measurements. The triangles in the sketches indicate guanines and point in the 5′–3′ direction. The G-tetrad is shown in the middle. Bottom panel: CD spectra reflecting the acid-induced transition of a DNA fragment d(TCCCCACCTTCCCCACCCTCCCCACCCTCCCCA) of a c-myc human oncogene into an intercalated cytosine quadruplex. The oligonucleotide was dissolved in Robinson–Britton buffer, pH 9.2 [24 mM (H3PO4 + H3BO3 + CH3COOH) + 82 mM NaOH]. The pH value was changed directly in the CD cell by addition of dilute HCl. The triangles in the sketch indicate cytosines and point in the 5′–3′ direction. The C+·C pair is shown in the insert.
Mentions: Guanine quadruplexes are of many types but all of them are based on guanine tetrads (Figure 4, upper panels). There are two basic types of the guanine quadruplexes. The spectra of parallel quadruplexes have a dominant positive band at 260 nm, whereas the spectra of anti-parallel quadruplexes have a negative band at 260 nm and positive band at 290 nm (Figure 4A and B, respectively) (12,42–45). Both quadruplex types display an additional characteristic positive peak at 210 nm. The different CD of the parallel and anti-parallel quadruplexes originates from different stacking interactions (12) of the guanosine residues distinctly oriented around their glycosidic bonds. Intermolecular guanine quadruplexes form slowly and also transitions between different quadruplex types are slow. Quadruplex formation is induced by physiologically relevant cations namely potassium, although ethanol is a still more effective inducer (46,47). The long-wavelength CD spectrum of a parallel quadruplex is similar to the CD spectrum of the A-form. This may suggest a similar base stacking in these two conformations (48,49). The quadruplex, however, has a positive band at 210 nm, whereas the A-form displays a deep negative one (compare Figures 4A and 3A).Figure 4.

Bottom Line: This fast and simple method can be used at low- as well as high-DNA concentrations and with short- as well as long-DNA molecules.The course of detected CD spectral changes makes possible to distinguish between gradual changes within a single DNA conformation and cooperative isomerizations between discrete structural states.It enables measuring kinetics of the appearance of particular conformers and determination of their thermodynamic parameters.

View Article: PubMed Central - PubMed

Affiliation: Institute of Biophysics, vvi Academy of Sciences of the Czech Republic, Brno, Czech Republic. kypr@ibp.cz

ABSTRACT
Here we review studies that provided important information about conformational properties of DNA using circular dichroic (CD) spectroscopy. The conformational properties include the B-family of structures, A-form, Z-form, guanine quadruplexes, cytosine quadruplexes, triplexes and other less characterized structures. CD spectroscopy is extremely sensitive and relatively inexpensive. This fast and simple method can be used at low- as well as high-DNA concentrations and with short- as well as long-DNA molecules. The samples can easily be titrated with various agents to cause conformational isomerizations of DNA. The course of detected CD spectral changes makes possible to distinguish between gradual changes within a single DNA conformation and cooperative isomerizations between discrete structural states. It enables measuring kinetics of the appearance of particular conformers and determination of their thermodynamic parameters. In careful hands, CD spectroscopy is a valuable tool for mapping conformational properties of particular DNA molecules. Due to its numerous advantages, CD spectroscopy significantly participated in all basic conformational findings on DNA.

Show MeSH