Limits...
Circular dichroism and conformational polymorphism of DNA.

Kypr J, Kejnovská I, Renciuk D, Vorlícková M - Nucleic Acids Res. (2009)

Bottom Line: This fast and simple method can be used at low- as well as high-DNA concentrations and with short- as well as long-DNA molecules.The course of detected CD spectral changes makes possible to distinguish between gradual changes within a single DNA conformation and cooperative isomerizations between discrete structural states.It enables measuring kinetics of the appearance of particular conformers and determination of their thermodynamic parameters.

View Article: PubMed Central - PubMed

Affiliation: Institute of Biophysics, vvi Academy of Sciences of the Czech Republic, Brno, Czech Republic. kypr@ibp.cz

ABSTRACT
Here we review studies that provided important information about conformational properties of DNA using circular dichroic (CD) spectroscopy. The conformational properties include the B-family of structures, A-form, Z-form, guanine quadruplexes, cytosine quadruplexes, triplexes and other less characterized structures. CD spectroscopy is extremely sensitive and relatively inexpensive. This fast and simple method can be used at low- as well as high-DNA concentrations and with short- as well as long-DNA molecules. The samples can easily be titrated with various agents to cause conformational isomerizations of DNA. The course of detected CD spectral changes makes possible to distinguish between gradual changes within a single DNA conformation and cooperative isomerizations between discrete structural states. It enables measuring kinetics of the appearance of particular conformers and determination of their thermodynamic parameters. In careful hands, CD spectroscopy is a valuable tool for mapping conformational properties of particular DNA molecules. Due to its numerous advantages, CD spectroscopy significantly participated in all basic conformational findings on DNA.

Show MeSH
B–A and B–Z transitions of DNA. (A) Left panel: CD spectra reflecting trifluorethanol-induced B–A transition of d(GCGGCGACTGGTGAGTACGC) duplex. Insert: the transition monitored at 266 nm. Right panel: CD spectra of RNA of the same sequence (U instead of T) duplexed with complementary DNA strand. (B) CD spectra reflecting trifluorethanol-induced B–Z (left panel) and Z–Z′ (right panel) transitions of poly[d(GC)] duplex. Insert: the transitions monitored at 291 nm. In this figure, TFE was added to the oligonucleotides dissolved in 1 mM Na phosphate, 0.3 mM EDTA, pH 7 and CD spectra were measured at 0°C.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC2665218&req=5

Figure 3: B–A and B–Z transitions of DNA. (A) Left panel: CD spectra reflecting trifluorethanol-induced B–A transition of d(GCGGCGACTGGTGAGTACGC) duplex. Insert: the transition monitored at 266 nm. Right panel: CD spectra of RNA of the same sequence (U instead of T) duplexed with complementary DNA strand. (B) CD spectra reflecting trifluorethanol-induced B–Z (left panel) and Z–Z′ (right panel) transitions of poly[d(GC)] duplex. Insert: the transitions monitored at 291 nm. In this figure, TFE was added to the oligonucleotides dissolved in 1 mM Na phosphate, 0.3 mM EDTA, pH 7 and CD spectra were measured at 0°C.

Mentions: A-form is a constitutive conformation of RNA. DNA adopts the A-form in aqueous ethanol and other solutions (25). Some molecules of DNA (e.g. poly[d(A)]·poly[d(T)], Figure 1) do not adopt the A-form conformation at all. Others [e.g. (G + C) rich DNA fragments] (18,26) exhibit A-form features even in aqueous solution. The CD spectrum of poly[d(G)]·poly[d(C)] (Figure 1) is very similar to that of the true A-form DNA (Figure 3A). The CD spectrum of A-form DNA of heterogeneous primary structure is practically the same as that of the A-form of the corresponding RNA or RNA/DNA hybrid with the same primary structure. The spectrum is characterized by not only a dominant positive band at 260 nm but also a negative band at 210 nm (Figure 3A). The amplitude of the positive band is usually within 7–12 M−1cm−1 depending on the base sequence.Figure 3.


Circular dichroism and conformational polymorphism of DNA.

Kypr J, Kejnovská I, Renciuk D, Vorlícková M - Nucleic Acids Res. (2009)

B–A and B–Z transitions of DNA. (A) Left panel: CD spectra reflecting trifluorethanol-induced B–A transition of d(GCGGCGACTGGTGAGTACGC) duplex. Insert: the transition monitored at 266 nm. Right panel: CD spectra of RNA of the same sequence (U instead of T) duplexed with complementary DNA strand. (B) CD spectra reflecting trifluorethanol-induced B–Z (left panel) and Z–Z′ (right panel) transitions of poly[d(GC)] duplex. Insert: the transitions monitored at 291 nm. In this figure, TFE was added to the oligonucleotides dissolved in 1 mM Na phosphate, 0.3 mM EDTA, pH 7 and CD spectra were measured at 0°C.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC2665218&req=5

Figure 3: B–A and B–Z transitions of DNA. (A) Left panel: CD spectra reflecting trifluorethanol-induced B–A transition of d(GCGGCGACTGGTGAGTACGC) duplex. Insert: the transition monitored at 266 nm. Right panel: CD spectra of RNA of the same sequence (U instead of T) duplexed with complementary DNA strand. (B) CD spectra reflecting trifluorethanol-induced B–Z (left panel) and Z–Z′ (right panel) transitions of poly[d(GC)] duplex. Insert: the transitions monitored at 291 nm. In this figure, TFE was added to the oligonucleotides dissolved in 1 mM Na phosphate, 0.3 mM EDTA, pH 7 and CD spectra were measured at 0°C.
Mentions: A-form is a constitutive conformation of RNA. DNA adopts the A-form in aqueous ethanol and other solutions (25). Some molecules of DNA (e.g. poly[d(A)]·poly[d(T)], Figure 1) do not adopt the A-form conformation at all. Others [e.g. (G + C) rich DNA fragments] (18,26) exhibit A-form features even in aqueous solution. The CD spectrum of poly[d(G)]·poly[d(C)] (Figure 1) is very similar to that of the true A-form DNA (Figure 3A). The CD spectrum of A-form DNA of heterogeneous primary structure is practically the same as that of the A-form of the corresponding RNA or RNA/DNA hybrid with the same primary structure. The spectrum is characterized by not only a dominant positive band at 260 nm but also a negative band at 210 nm (Figure 3A). The amplitude of the positive band is usually within 7–12 M−1cm−1 depending on the base sequence.Figure 3.

Bottom Line: This fast and simple method can be used at low- as well as high-DNA concentrations and with short- as well as long-DNA molecules.The course of detected CD spectral changes makes possible to distinguish between gradual changes within a single DNA conformation and cooperative isomerizations between discrete structural states.It enables measuring kinetics of the appearance of particular conformers and determination of their thermodynamic parameters.

View Article: PubMed Central - PubMed

Affiliation: Institute of Biophysics, vvi Academy of Sciences of the Czech Republic, Brno, Czech Republic. kypr@ibp.cz

ABSTRACT
Here we review studies that provided important information about conformational properties of DNA using circular dichroic (CD) spectroscopy. The conformational properties include the B-family of structures, A-form, Z-form, guanine quadruplexes, cytosine quadruplexes, triplexes and other less characterized structures. CD spectroscopy is extremely sensitive and relatively inexpensive. This fast and simple method can be used at low- as well as high-DNA concentrations and with short- as well as long-DNA molecules. The samples can easily be titrated with various agents to cause conformational isomerizations of DNA. The course of detected CD spectral changes makes possible to distinguish between gradual changes within a single DNA conformation and cooperative isomerizations between discrete structural states. It enables measuring kinetics of the appearance of particular conformers and determination of their thermodynamic parameters. In careful hands, CD spectroscopy is a valuable tool for mapping conformational properties of particular DNA molecules. Due to its numerous advantages, CD spectroscopy significantly participated in all basic conformational findings on DNA.

Show MeSH