Limits...
Anopheles pseudowillmori is the predominant malaria vector in Motuo County, Tibet Autonomous Region.

Wu S, Pan JY, Wang XZ, Zhou SS, Zhang GQ, Liu Q, Tang LH - Malar. J. (2009)

Bottom Line: Among them, 3,602 (98.0%) were Anopheles pseudowillmori and 73 (2.0%) were Anopheles willmori.The Plasmodium vivax SSUrDNA fragment was amplified in two of 360 pooled An. pseudowillmori samples.The local An. maculatus group comprises the species An. pseudowillmori and An. willmori.

View Article: PubMed Central - HTML - PubMed

Affiliation: National Institute of Parasitic Diseases, Chinese Center for Disease Control and Prevention, Shanghai, PR China. jswu167@126.com

ABSTRACT

Background: Malaria is endemic in Linzhi Prefecture in the Tibet Autonomous Region (TAR), but the vector for malaria transmission had never been identified.

Methods: Adult Anopheles spp. were collected in Motuo County, Linzhi Prefecture on the Sino-Indian border in July and August, 2007. Multiplex PCR was adopted for species identification, and a nested PCR approach was used to detect sporozoites in the salivary glands of the mosquitoes.

Results: 3,675 mosquitoes of the Anopheles maculatus group were collected and processed for species identification. Among them, 3,602 (98.0%) were Anopheles pseudowillmori and 73 (2.0%) were Anopheles willmori. The Plasmodium vivax SSUrDNA fragment was amplified in two of 360 pooled An. pseudowillmori samples.

Conclusion: The local An. maculatus group comprises the species An. pseudowillmori and An. willmori. Anopheles pseudowillmori is considered the sole malaria vector in Motuo County in Linzhi Prefecture.

Show MeSH

Related in: MedlinePlus

Sporozoite detection by PCR. Ethidium bromide-stained PCR products from the nested PCR approach for sporozoite detection. Lane M: 100 bp ladder; lane 1: positive control; lanes 2–3: pooled samples from Motuo County, TAR; lane 4: negative control.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC2662868&req=5

Figure 3: Sporozoite detection by PCR. Ethidium bromide-stained PCR products from the nested PCR approach for sporozoite detection. Lane M: 100 bp ladder; lane 1: positive control; lanes 2–3: pooled samples from Motuo County, TAR; lane 4: negative control.

Mentions: A 121 bp fragment was amplified from two of the 360 pooled An. pseudowillmori samples (Figure 3). Cloning and sequencing of the product confirmed the presence of the P. vivax SSUrDNA fragment which was found to be identical with the previously reported sequence: 5'-ACTTCCAAGCCGAAGCAAAGAAAGTCCTTAAAAAGAATCATTTTAATTAAAAGAACACATAATAGCAAAA TGCGCACAAAGTCGATACGAAGTATCAGTTATGTGGATTAAGCTAGAAGCG-3' (AF145335, nt 520 – 640). The amplification of seven pooled An. willmori samples yielded no positive results.


Anopheles pseudowillmori is the predominant malaria vector in Motuo County, Tibet Autonomous Region.

Wu S, Pan JY, Wang XZ, Zhou SS, Zhang GQ, Liu Q, Tang LH - Malar. J. (2009)

Sporozoite detection by PCR. Ethidium bromide-stained PCR products from the nested PCR approach for sporozoite detection. Lane M: 100 bp ladder; lane 1: positive control; lanes 2–3: pooled samples from Motuo County, TAR; lane 4: negative control.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC2662868&req=5

Figure 3: Sporozoite detection by PCR. Ethidium bromide-stained PCR products from the nested PCR approach for sporozoite detection. Lane M: 100 bp ladder; lane 1: positive control; lanes 2–3: pooled samples from Motuo County, TAR; lane 4: negative control.
Mentions: A 121 bp fragment was amplified from two of the 360 pooled An. pseudowillmori samples (Figure 3). Cloning and sequencing of the product confirmed the presence of the P. vivax SSUrDNA fragment which was found to be identical with the previously reported sequence: 5'-ACTTCCAAGCCGAAGCAAAGAAAGTCCTTAAAAAGAATCATTTTAATTAAAAGAACACATAATAGCAAAA TGCGCACAAAGTCGATACGAAGTATCAGTTATGTGGATTAAGCTAGAAGCG-3' (AF145335, nt 520 – 640). The amplification of seven pooled An. willmori samples yielded no positive results.

Bottom Line: Among them, 3,602 (98.0%) were Anopheles pseudowillmori and 73 (2.0%) were Anopheles willmori.The Plasmodium vivax SSUrDNA fragment was amplified in two of 360 pooled An. pseudowillmori samples.The local An. maculatus group comprises the species An. pseudowillmori and An. willmori.

View Article: PubMed Central - HTML - PubMed

Affiliation: National Institute of Parasitic Diseases, Chinese Center for Disease Control and Prevention, Shanghai, PR China. jswu167@126.com

ABSTRACT

Background: Malaria is endemic in Linzhi Prefecture in the Tibet Autonomous Region (TAR), but the vector for malaria transmission had never been identified.

Methods: Adult Anopheles spp. were collected in Motuo County, Linzhi Prefecture on the Sino-Indian border in July and August, 2007. Multiplex PCR was adopted for species identification, and a nested PCR approach was used to detect sporozoites in the salivary glands of the mosquitoes.

Results: 3,675 mosquitoes of the Anopheles maculatus group were collected and processed for species identification. Among them, 3,602 (98.0%) were Anopheles pseudowillmori and 73 (2.0%) were Anopheles willmori. The Plasmodium vivax SSUrDNA fragment was amplified in two of 360 pooled An. pseudowillmori samples.

Conclusion: The local An. maculatus group comprises the species An. pseudowillmori and An. willmori. Anopheles pseudowillmori is considered the sole malaria vector in Motuo County in Linzhi Prefecture.

Show MeSH
Related in: MedlinePlus