Limits...
The Torso signaling pathway modulates a dual transcriptional switch to regulate tailless expression.

Chen YC, Lin SI, Chen YK, Chiang CS, Liaw GJ - Nucleic Acids Res. (2009)

Bottom Line: Hsf is a substrate of mitogen-activated protein kinase and S378 is the major phosphorylation site.Phosphorylation converts Hsf from a repressor to an activator that works with GAF to activate tll expression.In conclusion, the GAF/Hsf/Ttk69 complex binding to the tor-RE remodels local chromatin structure to repress tll expression and the Tor signaling pathway activate tll expression by modulating a dual transcriptional switch.

View Article: PubMed Central - PubMed

Affiliation: Department of Life Sciences and Institute of Genome Sciences, National Yang-Ming University, Taipei, 112 Taiwan, ROC.

ABSTRACT
The Torso (Tor) signaling pathway activates tailless (tll) expression by relieving tll repression. None of the repressors identified so far, such as Capicuo, Groucho and Tramtrack69 (Ttk69), bind to the tor response element (tor-RE) or fully elucidate tll repression. In this study, an expanded tll expression pattern was shown in embryos with reduced heat shock factor (hsf) and Trithorax-like (Trl) activities. The GAGA factor, GAF encoded by Trl, bound weakly to the tor-RE, and this binding was enhanced by both Hsf and Ttk69. A similar extent of expansion of tll expression was observed in embryos with simultaneous knockdown of hsf, Trl and ttk69 activities, and in embryos with constitutively active Tor. Hsf is a substrate of mitogen-activated protein kinase and S378 is the major phosphorylation site. Phosphorylation converts Hsf from a repressor to an activator that works with GAF to activate tll expression. In conclusion, the GAF/Hsf/Ttk69 complex binding to the tor-RE remodels local chromatin structure to repress tll expression and the Tor signaling pathway activate tll expression by modulating a dual transcriptional switch.

Show MeSH

Related in: MedlinePlus

GAF, Hsf and Ttk69 form a stable complex on the tor-RE, repressing tll expression. (A) The bacterially expressed Ttk69 (0.15 mg/ml) was used to test whether Ttk69 enhanced GAF/Hsf binding to the tor-RE using EMSA. The probe, GAF and Hsf were the same as those used in Figure 3A. GAF (2 μl in lanes 1, 5–7 and 9–12) and Hsf (3 μl in lanes 8–12) were mixed with various volumes of Ttk69 (1, 2 and 4 μl in lanes 2–4, 5–7 and 10–12; and 2 μl in lane 8). (B) A competition experiment shows association of Ttk69 with GAF/Hsf on the tor-RE. HSE,  (binding sites for Hsf and GAF are underlined and shadowed, respectively), and a Ttk69 binding site in the even-skipped cis-regulatory region, TCCTCATGGTCCTGCCGAGCAG (TBS), were used as competitor DNAs. The folds in molar excess of the competitor DNAs, HSE and TBS, are shown on top of lanes 2–5. Using a PhosphoImager, the radioactivities of the upper bands indicated by an arrow head in (A and B) were measured for quantitative analysis of DNA binding. (C–H) tll expression patterns in embryos with various combinations of RNAi to knockdown hsf, Trl or ttk69 activities, as shown at bottom of each panel. tll expression patterns in embryos with GFP (C) or TorD4021 (D) expression serve as controls. Embryos are arranged in a sagittal view, with the anterior towards the left.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC2651784&req=5

Figure 4: GAF, Hsf and Ttk69 form a stable complex on the tor-RE, repressing tll expression. (A) The bacterially expressed Ttk69 (0.15 mg/ml) was used to test whether Ttk69 enhanced GAF/Hsf binding to the tor-RE using EMSA. The probe, GAF and Hsf were the same as those used in Figure 3A. GAF (2 μl in lanes 1, 5–7 and 9–12) and Hsf (3 μl in lanes 8–12) were mixed with various volumes of Ttk69 (1, 2 and 4 μl in lanes 2–4, 5–7 and 10–12; and 2 μl in lane 8). (B) A competition experiment shows association of Ttk69 with GAF/Hsf on the tor-RE. HSE, (binding sites for Hsf and GAF are underlined and shadowed, respectively), and a Ttk69 binding site in the even-skipped cis-regulatory region, TCCTCATGGTCCTGCCGAGCAG (TBS), were used as competitor DNAs. The folds in molar excess of the competitor DNAs, HSE and TBS, are shown on top of lanes 2–5. Using a PhosphoImager, the radioactivities of the upper bands indicated by an arrow head in (A and B) were measured for quantitative analysis of DNA binding. (C–H) tll expression patterns in embryos with various combinations of RNAi to knockdown hsf, Trl or ttk69 activities, as shown at bottom of each panel. tll expression patterns in embryos with GFP (C) or TorD4021 (D) expression serve as controls. Embryos are arranged in a sagittal view, with the anterior towards the left.

Mentions: Our previous results showed that Ttk69 acts as an accessory factor to initiate tll repression (16). In addition, Pagans and colleagues (52) show that the interaction with GAF is required for Ttk69 to repress gene expression in the absence of Ttk69 binding sequences. Therefore, Ttk69 might form a complex with GAF/Hsf by interacting with GAF. To test this hypothesis, we examined whether Ttk69 enhances GAF/Hsf binding to the tor-RE using EMSA. The results showed that Ttk69 enhanced GAF and GAF/Hsf binding to the tor-RE by 5- and 18-fold, respectively (compare lanes 7 and 12 with 1 and 9 in Figure 4A). However, Ttk69 alone did not bind to the tor-RE (lanes 2-4), and did not enhance Hsf binding (lane 8) to the tor-RE. A tight association between Ttk69 and GAF/Hsf was revealed by competition experiments using TBS competitor DNA that contains the Ttk69 binding site in the even-skipped promoter (52). A 20-fold excess of HSE competitor DNA abolished the binding of GAF/Hsf/Ttk69 to the tor-RE (lane 2 in Figure 4B), whereas TBS in 40-fold excess did not interfere with GAF/Hsf/Ttk69 binding (lane 5 in Figure 4B). Results from shift-western blotting showed that both Ttk69 and Hsf were present in the DNA–protein complex (Supplementary Figure S4). Taking into consideration the fact that there was no TC5 in the probe used for EMSA and that Ttk69 physically interacts with GAF (53), these results indicated that GAF, Hsf and Ttk69 form a protein complex that binds tightly to the tor-RE, independently of TC5.Figure 4.


The Torso signaling pathway modulates a dual transcriptional switch to regulate tailless expression.

Chen YC, Lin SI, Chen YK, Chiang CS, Liaw GJ - Nucleic Acids Res. (2009)

GAF, Hsf and Ttk69 form a stable complex on the tor-RE, repressing tll expression. (A) The bacterially expressed Ttk69 (0.15 mg/ml) was used to test whether Ttk69 enhanced GAF/Hsf binding to the tor-RE using EMSA. The probe, GAF and Hsf were the same as those used in Figure 3A. GAF (2 μl in lanes 1, 5–7 and 9–12) and Hsf (3 μl in lanes 8–12) were mixed with various volumes of Ttk69 (1, 2 and 4 μl in lanes 2–4, 5–7 and 10–12; and 2 μl in lane 8). (B) A competition experiment shows association of Ttk69 with GAF/Hsf on the tor-RE. HSE,  (binding sites for Hsf and GAF are underlined and shadowed, respectively), and a Ttk69 binding site in the even-skipped cis-regulatory region, TCCTCATGGTCCTGCCGAGCAG (TBS), were used as competitor DNAs. The folds in molar excess of the competitor DNAs, HSE and TBS, are shown on top of lanes 2–5. Using a PhosphoImager, the radioactivities of the upper bands indicated by an arrow head in (A and B) were measured for quantitative analysis of DNA binding. (C–H) tll expression patterns in embryos with various combinations of RNAi to knockdown hsf, Trl or ttk69 activities, as shown at bottom of each panel. tll expression patterns in embryos with GFP (C) or TorD4021 (D) expression serve as controls. Embryos are arranged in a sagittal view, with the anterior towards the left.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC2651784&req=5

Figure 4: GAF, Hsf and Ttk69 form a stable complex on the tor-RE, repressing tll expression. (A) The bacterially expressed Ttk69 (0.15 mg/ml) was used to test whether Ttk69 enhanced GAF/Hsf binding to the tor-RE using EMSA. The probe, GAF and Hsf were the same as those used in Figure 3A. GAF (2 μl in lanes 1, 5–7 and 9–12) and Hsf (3 μl in lanes 8–12) were mixed with various volumes of Ttk69 (1, 2 and 4 μl in lanes 2–4, 5–7 and 10–12; and 2 μl in lane 8). (B) A competition experiment shows association of Ttk69 with GAF/Hsf on the tor-RE. HSE, (binding sites for Hsf and GAF are underlined and shadowed, respectively), and a Ttk69 binding site in the even-skipped cis-regulatory region, TCCTCATGGTCCTGCCGAGCAG (TBS), were used as competitor DNAs. The folds in molar excess of the competitor DNAs, HSE and TBS, are shown on top of lanes 2–5. Using a PhosphoImager, the radioactivities of the upper bands indicated by an arrow head in (A and B) were measured for quantitative analysis of DNA binding. (C–H) tll expression patterns in embryos with various combinations of RNAi to knockdown hsf, Trl or ttk69 activities, as shown at bottom of each panel. tll expression patterns in embryos with GFP (C) or TorD4021 (D) expression serve as controls. Embryos are arranged in a sagittal view, with the anterior towards the left.
Mentions: Our previous results showed that Ttk69 acts as an accessory factor to initiate tll repression (16). In addition, Pagans and colleagues (52) show that the interaction with GAF is required for Ttk69 to repress gene expression in the absence of Ttk69 binding sequences. Therefore, Ttk69 might form a complex with GAF/Hsf by interacting with GAF. To test this hypothesis, we examined whether Ttk69 enhances GAF/Hsf binding to the tor-RE using EMSA. The results showed that Ttk69 enhanced GAF and GAF/Hsf binding to the tor-RE by 5- and 18-fold, respectively (compare lanes 7 and 12 with 1 and 9 in Figure 4A). However, Ttk69 alone did not bind to the tor-RE (lanes 2-4), and did not enhance Hsf binding (lane 8) to the tor-RE. A tight association between Ttk69 and GAF/Hsf was revealed by competition experiments using TBS competitor DNA that contains the Ttk69 binding site in the even-skipped promoter (52). A 20-fold excess of HSE competitor DNA abolished the binding of GAF/Hsf/Ttk69 to the tor-RE (lane 2 in Figure 4B), whereas TBS in 40-fold excess did not interfere with GAF/Hsf/Ttk69 binding (lane 5 in Figure 4B). Results from shift-western blotting showed that both Ttk69 and Hsf were present in the DNA–protein complex (Supplementary Figure S4). Taking into consideration the fact that there was no TC5 in the probe used for EMSA and that Ttk69 physically interacts with GAF (53), these results indicated that GAF, Hsf and Ttk69 form a protein complex that binds tightly to the tor-RE, independently of TC5.Figure 4.

Bottom Line: Hsf is a substrate of mitogen-activated protein kinase and S378 is the major phosphorylation site.Phosphorylation converts Hsf from a repressor to an activator that works with GAF to activate tll expression.In conclusion, the GAF/Hsf/Ttk69 complex binding to the tor-RE remodels local chromatin structure to repress tll expression and the Tor signaling pathway activate tll expression by modulating a dual transcriptional switch.

View Article: PubMed Central - PubMed

Affiliation: Department of Life Sciences and Institute of Genome Sciences, National Yang-Ming University, Taipei, 112 Taiwan, ROC.

ABSTRACT
The Torso (Tor) signaling pathway activates tailless (tll) expression by relieving tll repression. None of the repressors identified so far, such as Capicuo, Groucho and Tramtrack69 (Ttk69), bind to the tor response element (tor-RE) or fully elucidate tll repression. In this study, an expanded tll expression pattern was shown in embryos with reduced heat shock factor (hsf) and Trithorax-like (Trl) activities. The GAGA factor, GAF encoded by Trl, bound weakly to the tor-RE, and this binding was enhanced by both Hsf and Ttk69. A similar extent of expansion of tll expression was observed in embryos with simultaneous knockdown of hsf, Trl and ttk69 activities, and in embryos with constitutively active Tor. Hsf is a substrate of mitogen-activated protein kinase and S378 is the major phosphorylation site. Phosphorylation converts Hsf from a repressor to an activator that works with GAF to activate tll expression. In conclusion, the GAF/Hsf/Ttk69 complex binding to the tor-RE remodels local chromatin structure to repress tll expression and the Tor signaling pathway activate tll expression by modulating a dual transcriptional switch.

Show MeSH
Related in: MedlinePlus