Limits...
Vitamin K epoxide reductase complex subunit 1 (Vkorc1) haplotype diversity in mouse priority strains.

Song Y, Vera N, Kohn MH - BMC Res Notes (2008)

Bottom Line: We detected no significant association of Vkorc1 haplotypes with PT, BMD and BMC within each subspecies of Mus.Vkorc1 haplotype sequences divergence between subspecies was associated with PT, BMD and BMC.Differences in these phenotypes between subspecies also should not be attributed to Vkorc1 variants, but should be viewed as a result of genome wide genetic divergence.

View Article: PubMed Central - HTML - PubMed

Affiliation: Department of Ecology and Evolutionary Biology, Institute of Biotechnology & Bioengineering, Rice University, MS 170 205A Anderson Biology Lab 6100 Main Street, Houston, Texas 77005, USA. hmkohn@rice.edu.

ABSTRACT

Background: Polymorphisms in the vitamin K-epoxide reductase complex subunit 1 gene, Vkorc1, could affect blood coagulation and other vitamin K-dependent proteins, such as osteocalcin (bone Gla protein, BGP). Here we sequenced the Vkorc1 gene in 40 mouse priority strains. We analyzed Vkorc1 haplotypes with respect to prothrombin time (PT) and bone mineral density and composition (BMD and BMC); phenotypes expected to be vitamin K-dependent and represented by data in the Mouse Phenome Database (MPD).

Findings: In the commonly used laboratory strains of Mus musculus domesticus we identified only four haplotypes differing in the intron or 5' region sequence of the Vkorc1. Six haplotypes differing by coding and non-coding polymorphisms were identified in the other subspecies of Mus. We detected no significant association of Vkorc1 haplotypes with PT, BMD and BMC within each subspecies of Mus. Vkorc1 haplotype sequences divergence between subspecies was associated with PT, BMD and BMC.

Conclusion: Phenotypic variation in PT, BMD and BMC within subspecies of Mus, while substantial, appears to be dominated by genetic variation in genes other than the Vkorc1. This was particularly evident for M. m. domesticus, where a single haplotype was observed in conjunction with virtually the entire range of PT, BMD and BMC values of all 5 subspecies of Mus included in this study. Differences in these phenotypes between subspecies also should not be attributed to Vkorc1 variants, but should be viewed as a result of genome wide genetic divergence.

No MeSH data available.


Related in: MedlinePlus

a. Neighbor-joining (NJ) tree showing evolutionary relationships of priority strains as inferred based on the Vkorc1 and its 5' region. Each strain is followed by the subspecies name and the haplotype group it belongs to [c.f. Additional file 1]. IN and WD indicate whether strains are inbred or wild derived, respectively. Too many inbred strains are represented by C57BL/6J since they share one haplotype. Numbers on the branch indicate the bootstrap values from NJ and MP analyses. b. The mean and standard variation of the phenotypes PT and BMD/C. The clades I-IV are shown on the X-axes and their corresponding PT, BMD and BMC measurements are shown on the Y-axes.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC2629770&req=5

Figure 2: a. Neighbor-joining (NJ) tree showing evolutionary relationships of priority strains as inferred based on the Vkorc1 and its 5' region. Each strain is followed by the subspecies name and the haplotype group it belongs to [c.f. Additional file 1]. IN and WD indicate whether strains are inbred or wild derived, respectively. Too many inbred strains are represented by C57BL/6J since they share one haplotype. Numbers on the branch indicate the bootstrap values from NJ and MP analyses. b. The mean and standard variation of the phenotypes PT and BMD/C. The clades I-IV are shown on the X-axes and their corresponding PT, BMD and BMC measurements are shown on the Y-axes.

Mentions: a. Genomic organization of the mouse vitamin K epoxide reductase complex subunit 1 gene (Vkorc1) and sequencing strategy. Exons are depicted in black and the untranslated regions (3'- and 5'-UTR) are shaded in gray. +1 indicates the transcription start. The primer pairs used to amplify segments 1–4 were (5' to 3') -1056seg1F CAC GAC GTT GTA AAA CGA CGG TCT GGG AAA TCA CAG GAA, -109seg1R GGA TAA CAA TTT CAC ACA GGC TAG GAA TGC TGG CGT GGT A, -205seg2F CAC GAC GTT GTA AAA CGA CTG CAG CCT CTC CAA CTA CAA T, 688seg2R GGA TAA CAA TTT CAC ACA GGA TGT GCC ACC TCA CAA ACA A, 726seg3F CAC GAC GTT GTA AAA CGA CCG TTC GGG AGT TGA GTC TCT, 1712seg3R GGA TAA CAA TTT CAC ACA GGA CCT ACC AGG TGT GGT CCA A, 1671seg4F CAC GAC GTT GTA AAA CGA CGT GCT GGG ATT AAA GCA TGG, 2614seg4R GGA TAA CAA TTT CAC ACA GGG AAA GAC TGA CAC CCC GAA G. The M13 primer tail used for sequencing is shown in bold face type. F and R refer to forward primer and reverse primer, respectively. b. Overview of polymorphisms in the coding and 5' region of theVkorc1. For each polymorphism the location in the mouse reference sequence (Ensembl No. ENSMUSG00000030804) and whether these are synonymous or non-synonymous is indicated. Strains (represented by a three-letter code) representative for haplotypes 1–10 are shown. I-IV refer to the clades identified by phylogenetic analysis of Vkorc1 haplotypes (c.f. Figure 2b). Nucleotides different from those in the reference sequence are shaded in gray. -indicate insertions/deletions (indels) and blank spaces indicate ambiguous or missing sequence. Five multiple-base indels are replaced by X (CTGTAAAGCTACTATTAACAGGACGGTA), L (ACACA), O(ATTGGGT), P (CAGCCCC), and Q (AGA).


Vitamin K epoxide reductase complex subunit 1 (Vkorc1) haplotype diversity in mouse priority strains.

Song Y, Vera N, Kohn MH - BMC Res Notes (2008)

a. Neighbor-joining (NJ) tree showing evolutionary relationships of priority strains as inferred based on the Vkorc1 and its 5' region. Each strain is followed by the subspecies name and the haplotype group it belongs to [c.f. Additional file 1]. IN and WD indicate whether strains are inbred or wild derived, respectively. Too many inbred strains are represented by C57BL/6J since they share one haplotype. Numbers on the branch indicate the bootstrap values from NJ and MP analyses. b. The mean and standard variation of the phenotypes PT and BMD/C. The clades I-IV are shown on the X-axes and their corresponding PT, BMD and BMC measurements are shown on the Y-axes.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC2629770&req=5

Figure 2: a. Neighbor-joining (NJ) tree showing evolutionary relationships of priority strains as inferred based on the Vkorc1 and its 5' region. Each strain is followed by the subspecies name and the haplotype group it belongs to [c.f. Additional file 1]. IN and WD indicate whether strains are inbred or wild derived, respectively. Too many inbred strains are represented by C57BL/6J since they share one haplotype. Numbers on the branch indicate the bootstrap values from NJ and MP analyses. b. The mean and standard variation of the phenotypes PT and BMD/C. The clades I-IV are shown on the X-axes and their corresponding PT, BMD and BMC measurements are shown on the Y-axes.
Mentions: a. Genomic organization of the mouse vitamin K epoxide reductase complex subunit 1 gene (Vkorc1) and sequencing strategy. Exons are depicted in black and the untranslated regions (3'- and 5'-UTR) are shaded in gray. +1 indicates the transcription start. The primer pairs used to amplify segments 1–4 were (5' to 3') -1056seg1F CAC GAC GTT GTA AAA CGA CGG TCT GGG AAA TCA CAG GAA, -109seg1R GGA TAA CAA TTT CAC ACA GGC TAG GAA TGC TGG CGT GGT A, -205seg2F CAC GAC GTT GTA AAA CGA CTG CAG CCT CTC CAA CTA CAA T, 688seg2R GGA TAA CAA TTT CAC ACA GGA TGT GCC ACC TCA CAA ACA A, 726seg3F CAC GAC GTT GTA AAA CGA CCG TTC GGG AGT TGA GTC TCT, 1712seg3R GGA TAA CAA TTT CAC ACA GGA CCT ACC AGG TGT GGT CCA A, 1671seg4F CAC GAC GTT GTA AAA CGA CGT GCT GGG ATT AAA GCA TGG, 2614seg4R GGA TAA CAA TTT CAC ACA GGG AAA GAC TGA CAC CCC GAA G. The M13 primer tail used for sequencing is shown in bold face type. F and R refer to forward primer and reverse primer, respectively. b. Overview of polymorphisms in the coding and 5' region of theVkorc1. For each polymorphism the location in the mouse reference sequence (Ensembl No. ENSMUSG00000030804) and whether these are synonymous or non-synonymous is indicated. Strains (represented by a three-letter code) representative for haplotypes 1–10 are shown. I-IV refer to the clades identified by phylogenetic analysis of Vkorc1 haplotypes (c.f. Figure 2b). Nucleotides different from those in the reference sequence are shaded in gray. -indicate insertions/deletions (indels) and blank spaces indicate ambiguous or missing sequence. Five multiple-base indels are replaced by X (CTGTAAAGCTACTATTAACAGGACGGTA), L (ACACA), O(ATTGGGT), P (CAGCCCC), and Q (AGA).

Bottom Line: We detected no significant association of Vkorc1 haplotypes with PT, BMD and BMC within each subspecies of Mus.Vkorc1 haplotype sequences divergence between subspecies was associated with PT, BMD and BMC.Differences in these phenotypes between subspecies also should not be attributed to Vkorc1 variants, but should be viewed as a result of genome wide genetic divergence.

View Article: PubMed Central - HTML - PubMed

Affiliation: Department of Ecology and Evolutionary Biology, Institute of Biotechnology & Bioengineering, Rice University, MS 170 205A Anderson Biology Lab 6100 Main Street, Houston, Texas 77005, USA. hmkohn@rice.edu.

ABSTRACT

Background: Polymorphisms in the vitamin K-epoxide reductase complex subunit 1 gene, Vkorc1, could affect blood coagulation and other vitamin K-dependent proteins, such as osteocalcin (bone Gla protein, BGP). Here we sequenced the Vkorc1 gene in 40 mouse priority strains. We analyzed Vkorc1 haplotypes with respect to prothrombin time (PT) and bone mineral density and composition (BMD and BMC); phenotypes expected to be vitamin K-dependent and represented by data in the Mouse Phenome Database (MPD).

Findings: In the commonly used laboratory strains of Mus musculus domesticus we identified only four haplotypes differing in the intron or 5' region sequence of the Vkorc1. Six haplotypes differing by coding and non-coding polymorphisms were identified in the other subspecies of Mus. We detected no significant association of Vkorc1 haplotypes with PT, BMD and BMC within each subspecies of Mus. Vkorc1 haplotype sequences divergence between subspecies was associated with PT, BMD and BMC.

Conclusion: Phenotypic variation in PT, BMD and BMC within subspecies of Mus, while substantial, appears to be dominated by genetic variation in genes other than the Vkorc1. This was particularly evident for M. m. domesticus, where a single haplotype was observed in conjunction with virtually the entire range of PT, BMD and BMC values of all 5 subspecies of Mus included in this study. Differences in these phenotypes between subspecies also should not be attributed to Vkorc1 variants, but should be viewed as a result of genome wide genetic divergence.

No MeSH data available.


Related in: MedlinePlus