Limits...
Novel bimodular DNA aptamers with guanosine quadruplexes inhibit phylogenetically diverse HIV-1 reverse transcriptases.

Michalowski D, Chitima-Matsiga R, Held DM, Burke DH - Nucleic Acids Res. (2008)

Bottom Line: An aptamer carrying the original intra-quadruplex loops from RT6 inhibited RT in K(+) buffers but not in Na(+) buffers and displayed significant CD spectral broadening in Na(+) buffers, while R1T inhibited RT in both buffers and displayed less broadening in Na(+) buffers.The bimodular ssDNA aptamers inhibited RT from diverse primate lentiviruses with low nM IC(50) values.These data provide insight into the requirements for broad-spectrum RT inhibition by nucleic acid aptamers.

View Article: PubMed Central - PubMed

Affiliation: Department of Molecular Microbiology & Immunology, University of Missouri School of Medicine, Columbia, MO 65211, USA.

ABSTRACT
DNA aptamers RT5, RT6 and RT47 form a group of related sequences that inhibit HIV-1 reverse transcriptase (RT). The essential inhibitory structure is identified here as bimodular, with a 5' stem-loop module physically connected to a 3'-guanosine quadruplex module. The stem-loop tolerates considerable sequence plasticity. Connections between the guanosine triplets in the quadruplex could be simplified to a single nucleotide or a nonnucleic acid linker, such as hexaethylene glycol. All 12 quadruplex guanosines are required in an aptamer retaining most of the original loop sequence from RT6; only 11 are required for aptamer R1T (single T residue in intra-quadruplex loops). Circular dichroism (CD) spectroscopy gave ellipticity minima and maxima at 240 nm and 264 nm, indicating a parallel arrangement of the quadruplex strands. The simplified aptamers displayed increased overall stability. An aptamer carrying the original intra-quadruplex loops from RT6 inhibited RT in K(+) buffers but not in Na(+) buffers and displayed significant CD spectral broadening in Na(+) buffers, while R1T inhibited RT in both buffers and displayed less broadening in Na(+) buffers. The bimodular ssDNA aptamers inhibited RT from diverse primate lentiviruses with low nM IC(50) values. These data provide insight into the requirements for broad-spectrum RT inhibition by nucleic acid aptamers.

Show MeSH
Topological requirements. (A) Schematic diagrams of topological variants described in the text, assuming three-layer, parallel quadruplex stacks. (B) RT inhibition assays utilizing separated subdomains of R1T (‘Stem’ and ‘Q16’). Inhibition is essentially eliminated when the two domains are not physically connected. ‘Mix’ refers to a 1:1 mixture of stem and Q16 oligos, each at the indicated concentrations. ‘Ctrl’ is an irrelevant control DNA: 5′ d(GCGGGACAATGGAGAGAGGG). (C) RT inhibition assays in which the connector domain is replaced with HEG. (D) RT inhibition assays in which inter-module connection is via two strands, with 5′ and 3′ termini in the stem module (Dyl5) or between the second and third guanosine triplets (Acut).
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC2602765&req=5

Figure 5: Topological requirements. (A) Schematic diagrams of topological variants described in the text, assuming three-layer, parallel quadruplex stacks. (B) RT inhibition assays utilizing separated subdomains of R1T (‘Stem’ and ‘Q16’). Inhibition is essentially eliminated when the two domains are not physically connected. ‘Mix’ refers to a 1:1 mixture of stem and Q16 oligos, each at the indicated concentrations. ‘Ctrl’ is an irrelevant control DNA: 5′ d(GCGGGACAATGGAGAGAGGG). (C) RT inhibition assays in which the connector domain is replaced with HEG. (D) RT inhibition assays in which inter-module connection is via two strands, with 5′ and 3′ termini in the stem module (Dyl5) or between the second and third guanosine triplets (Acut).

Mentions: RT inhibition was measured for several variants of R1T to determine the importance of the physical connection between the two structural modules (Figure 5A). No inhibition was observed for a 28-nt oligo containing only the 5′ stem–loop motif (stem), nor for a 16-nt oligo containing the (TGGG)4 quadruplex motif (Q16). Similarly, no inhibition was observed when both oligos were added simultaneously at a ratio of 1:1, even when their individual concentrations were increased to 3000 nM (Figure 5B). A physical (covalent) connection between the DNA duplex and G-quadruplex is therefore required to effect inhibition.Figure 5.


Novel bimodular DNA aptamers with guanosine quadruplexes inhibit phylogenetically diverse HIV-1 reverse transcriptases.

Michalowski D, Chitima-Matsiga R, Held DM, Burke DH - Nucleic Acids Res. (2008)

Topological requirements. (A) Schematic diagrams of topological variants described in the text, assuming three-layer, parallel quadruplex stacks. (B) RT inhibition assays utilizing separated subdomains of R1T (‘Stem’ and ‘Q16’). Inhibition is essentially eliminated when the two domains are not physically connected. ‘Mix’ refers to a 1:1 mixture of stem and Q16 oligos, each at the indicated concentrations. ‘Ctrl’ is an irrelevant control DNA: 5′ d(GCGGGACAATGGAGAGAGGG). (C) RT inhibition assays in which the connector domain is replaced with HEG. (D) RT inhibition assays in which inter-module connection is via two strands, with 5′ and 3′ termini in the stem module (Dyl5) or between the second and third guanosine triplets (Acut).
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC2602765&req=5

Figure 5: Topological requirements. (A) Schematic diagrams of topological variants described in the text, assuming three-layer, parallel quadruplex stacks. (B) RT inhibition assays utilizing separated subdomains of R1T (‘Stem’ and ‘Q16’). Inhibition is essentially eliminated when the two domains are not physically connected. ‘Mix’ refers to a 1:1 mixture of stem and Q16 oligos, each at the indicated concentrations. ‘Ctrl’ is an irrelevant control DNA: 5′ d(GCGGGACAATGGAGAGAGGG). (C) RT inhibition assays in which the connector domain is replaced with HEG. (D) RT inhibition assays in which inter-module connection is via two strands, with 5′ and 3′ termini in the stem module (Dyl5) or between the second and third guanosine triplets (Acut).
Mentions: RT inhibition was measured for several variants of R1T to determine the importance of the physical connection between the two structural modules (Figure 5A). No inhibition was observed for a 28-nt oligo containing only the 5′ stem–loop motif (stem), nor for a 16-nt oligo containing the (TGGG)4 quadruplex motif (Q16). Similarly, no inhibition was observed when both oligos were added simultaneously at a ratio of 1:1, even when their individual concentrations were increased to 3000 nM (Figure 5B). A physical (covalent) connection between the DNA duplex and G-quadruplex is therefore required to effect inhibition.Figure 5.

Bottom Line: An aptamer carrying the original intra-quadruplex loops from RT6 inhibited RT in K(+) buffers but not in Na(+) buffers and displayed significant CD spectral broadening in Na(+) buffers, while R1T inhibited RT in both buffers and displayed less broadening in Na(+) buffers.The bimodular ssDNA aptamers inhibited RT from diverse primate lentiviruses with low nM IC(50) values.These data provide insight into the requirements for broad-spectrum RT inhibition by nucleic acid aptamers.

View Article: PubMed Central - PubMed

Affiliation: Department of Molecular Microbiology & Immunology, University of Missouri School of Medicine, Columbia, MO 65211, USA.

ABSTRACT
DNA aptamers RT5, RT6 and RT47 form a group of related sequences that inhibit HIV-1 reverse transcriptase (RT). The essential inhibitory structure is identified here as bimodular, with a 5' stem-loop module physically connected to a 3'-guanosine quadruplex module. The stem-loop tolerates considerable sequence plasticity. Connections between the guanosine triplets in the quadruplex could be simplified to a single nucleotide or a nonnucleic acid linker, such as hexaethylene glycol. All 12 quadruplex guanosines are required in an aptamer retaining most of the original loop sequence from RT6; only 11 are required for aptamer R1T (single T residue in intra-quadruplex loops). Circular dichroism (CD) spectroscopy gave ellipticity minima and maxima at 240 nm and 264 nm, indicating a parallel arrangement of the quadruplex strands. The simplified aptamers displayed increased overall stability. An aptamer carrying the original intra-quadruplex loops from RT6 inhibited RT in K(+) buffers but not in Na(+) buffers and displayed significant CD spectral broadening in Na(+) buffers, while R1T inhibited RT in both buffers and displayed less broadening in Na(+) buffers. The bimodular ssDNA aptamers inhibited RT from diverse primate lentiviruses with low nM IC(50) values. These data provide insight into the requirements for broad-spectrum RT inhibition by nucleic acid aptamers.

Show MeSH