Limits...
Stability and kinetics of G-quadruplex structures.

Lane AN, Chaires JB, Gray RD, Trent JO - Nucleic Acids Res. (2008)

Bottom Line: Significant gaps in the literature have been identified, that should be filled by a systematic study of well-defined quadruplexes not only to provide the basic understanding of stability both for design purposes, but also as it relates to in vivo occurrence of quadruplexes.Quadruplex structures fold and unfold comparatively slowly, and DNA unwinding events associated with transcription and replication may be operating far from equilibrium.The kinetics of formation and resolution of quadruplexes, and methodologies are discussed in the context of stability and their possible biological occurrence.

View Article: PubMed Central - PubMed

Affiliation: Structural Biology Program, JG Brown Cancer Center, University of Louisville, KY 40202, USA. anlane01@gwise.louisville.edu

ABSTRACT
In this review, we give an overview of recent literature on the structure and stability of unimolecular G-rich quadruplex structures that are relevant to drug design and for in vivo function. The unifying theme in this review is energetics. The thermodynamic stability of quadruplexes has not been studied in the same detail as DNA and RNA duplexes, and there are important differences in the balance of forces between these classes of folded oligonucleotides. We provide an overview of the principles of stability and where available the experimental data that report on these principles. Significant gaps in the literature have been identified, that should be filled by a systematic study of well-defined quadruplexes not only to provide the basic understanding of stability both for design purposes, but also as it relates to in vivo occurrence of quadruplexes. Techniques that are commonly applied to the determination of the structure, stability and folding are discussed in terms of information content and limitations. Quadruplex structures fold and unfold comparatively slowly, and DNA unwinding events associated with transcription and replication may be operating far from equilibrium. The kinetics of formation and resolution of quadruplexes, and methodologies are discussed in the context of stability and their possible biological occurrence.

Show MeSH
Topologies give rise to radically different structural appearance. Structures and electrostatic potential colored surfaces of the parallel (top), ‘basket’ lateral, diagonal, lateral loop (middle) and the all double chain reversal (bottom) topologies. The electrostatic surfaces are colored red (−10 kT/e) to blue (10 kT/e) and the bases are guanine in green, thymine in blue, and adenine in red.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC2553573&req=5

Figure 4: Topologies give rise to radically different structural appearance. Structures and electrostatic potential colored surfaces of the parallel (top), ‘basket’ lateral, diagonal, lateral loop (middle) and the all double chain reversal (bottom) topologies. The electrostatic surfaces are colored red (−10 kT/e) to blue (10 kT/e) and the bases are guanine in green, thymine in blue, and adenine in red.

Mentions: It should be noted for the all parallel high resolution (0.95 Å) crystal structure (44) d(TGGGGT)4 has the following distances: O3′ top stack to O5′ bottom stack for three G-quartet stacks is 7.3–7.9 Å: O3′ top stack to O5′ bottom stack for four G-quartet stacks is 11.1–12.2 Å, O5′ to O5′ of the adjacent same stack 14–15 Å, O3′ to O3′ of adjacent same stack 15–16 Å, O5′ to O5′ of the opposite same stack 19–21 Å, O3′ to O3′ of opposite same stack 20–22 Å (Table 1). Furthermore, the topology-dependent groove widths (Figure 1) give rise to different electronic distributions from the negatively charged phosphates. This is shown in Figure 4, which shows the space filling models colored by electrostatic potential calculated for 150 mM K+ using the Poisson–Boltzmann program APBS (45,46). These three representative structures demonstrate that shape, electrostatics and topology are intimately linked. The double chain reversal ‘propeller’ structure (Figure 3, bottom) is a flat, plate like object compared to the other topologies, which appear more globular in shape. Indeed, the propeller structure stands out among all the topologies so far solved experimentally in terms of its overall shape, groove structures and electrostatic potential, suggesting that it should have physical properties that are readily distinguishable from all of the other folds as a group (not shown). Using the APBS program, we have calculated the electrostatic energy of different conformations of the human telomere sequence d(GGGTTAGGGTTAGGGTTAGGG). The parallel form was calculated to be 2769 kcal mol−1, hybrid 1 2904 kcal mol−1, hybrid 2 2925 kcal mol−1 and basket form 2867 kcal mol−1. In order to compare the same number of nucleotides and thus atoms, the flanking bases were truncated. This shows that the electrostatic energy (essentially due too the unfavorable interactions between the closely spaced phosphodiesters) is high, and differs by up to 156 kcal mol−1 for these three conformations. For comparison the energy of an unfolded strand that was subjected to molecular dynamics and then energy minimized was 1842 kcal mol−1. Although this represents only one possible instance of an ensemble of conformations, it is expanded with respect to the folded conformations, and shows a much lower unfavorable electrostatic energy, as expected. These values imply that the folding has to overcome a rather large electrostatic energy that must be compensated by other forces. In part, this is likely to arise from ion condensation and specific ion binding, as discussed in more detail below.Figure 4.


Stability and kinetics of G-quadruplex structures.

Lane AN, Chaires JB, Gray RD, Trent JO - Nucleic Acids Res. (2008)

Topologies give rise to radically different structural appearance. Structures and electrostatic potential colored surfaces of the parallel (top), ‘basket’ lateral, diagonal, lateral loop (middle) and the all double chain reversal (bottom) topologies. The electrostatic surfaces are colored red (−10 kT/e) to blue (10 kT/e) and the bases are guanine in green, thymine in blue, and adenine in red.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC2553573&req=5

Figure 4: Topologies give rise to radically different structural appearance. Structures and electrostatic potential colored surfaces of the parallel (top), ‘basket’ lateral, diagonal, lateral loop (middle) and the all double chain reversal (bottom) topologies. The electrostatic surfaces are colored red (−10 kT/e) to blue (10 kT/e) and the bases are guanine in green, thymine in blue, and adenine in red.
Mentions: It should be noted for the all parallel high resolution (0.95 Å) crystal structure (44) d(TGGGGT)4 has the following distances: O3′ top stack to O5′ bottom stack for three G-quartet stacks is 7.3–7.9 Å: O3′ top stack to O5′ bottom stack for four G-quartet stacks is 11.1–12.2 Å, O5′ to O5′ of the adjacent same stack 14–15 Å, O3′ to O3′ of adjacent same stack 15–16 Å, O5′ to O5′ of the opposite same stack 19–21 Å, O3′ to O3′ of opposite same stack 20–22 Å (Table 1). Furthermore, the topology-dependent groove widths (Figure 1) give rise to different electronic distributions from the negatively charged phosphates. This is shown in Figure 4, which shows the space filling models colored by electrostatic potential calculated for 150 mM K+ using the Poisson–Boltzmann program APBS (45,46). These three representative structures demonstrate that shape, electrostatics and topology are intimately linked. The double chain reversal ‘propeller’ structure (Figure 3, bottom) is a flat, plate like object compared to the other topologies, which appear more globular in shape. Indeed, the propeller structure stands out among all the topologies so far solved experimentally in terms of its overall shape, groove structures and electrostatic potential, suggesting that it should have physical properties that are readily distinguishable from all of the other folds as a group (not shown). Using the APBS program, we have calculated the electrostatic energy of different conformations of the human telomere sequence d(GGGTTAGGGTTAGGGTTAGGG). The parallel form was calculated to be 2769 kcal mol−1, hybrid 1 2904 kcal mol−1, hybrid 2 2925 kcal mol−1 and basket form 2867 kcal mol−1. In order to compare the same number of nucleotides and thus atoms, the flanking bases were truncated. This shows that the electrostatic energy (essentially due too the unfavorable interactions between the closely spaced phosphodiesters) is high, and differs by up to 156 kcal mol−1 for these three conformations. For comparison the energy of an unfolded strand that was subjected to molecular dynamics and then energy minimized was 1842 kcal mol−1. Although this represents only one possible instance of an ensemble of conformations, it is expanded with respect to the folded conformations, and shows a much lower unfavorable electrostatic energy, as expected. These values imply that the folding has to overcome a rather large electrostatic energy that must be compensated by other forces. In part, this is likely to arise from ion condensation and specific ion binding, as discussed in more detail below.Figure 4.

Bottom Line: Significant gaps in the literature have been identified, that should be filled by a systematic study of well-defined quadruplexes not only to provide the basic understanding of stability both for design purposes, but also as it relates to in vivo occurrence of quadruplexes.Quadruplex structures fold and unfold comparatively slowly, and DNA unwinding events associated with transcription and replication may be operating far from equilibrium.The kinetics of formation and resolution of quadruplexes, and methodologies are discussed in the context of stability and their possible biological occurrence.

View Article: PubMed Central - PubMed

Affiliation: Structural Biology Program, JG Brown Cancer Center, University of Louisville, KY 40202, USA. anlane01@gwise.louisville.edu

ABSTRACT
In this review, we give an overview of recent literature on the structure and stability of unimolecular G-rich quadruplex structures that are relevant to drug design and for in vivo function. The unifying theme in this review is energetics. The thermodynamic stability of quadruplexes has not been studied in the same detail as DNA and RNA duplexes, and there are important differences in the balance of forces between these classes of folded oligonucleotides. We provide an overview of the principles of stability and where available the experimental data that report on these principles. Significant gaps in the literature have been identified, that should be filled by a systematic study of well-defined quadruplexes not only to provide the basic understanding of stability both for design purposes, but also as it relates to in vivo occurrence of quadruplexes. Techniques that are commonly applied to the determination of the structure, stability and folding are discussed in terms of information content and limitations. Quadruplex structures fold and unfold comparatively slowly, and DNA unwinding events associated with transcription and replication may be operating far from equilibrium. The kinetics of formation and resolution of quadruplexes, and methodologies are discussed in the context of stability and their possible biological occurrence.

Show MeSH