Limits...
Stability and kinetics of G-quadruplex structures.

Lane AN, Chaires JB, Gray RD, Trent JO - Nucleic Acids Res. (2008)

Bottom Line: Significant gaps in the literature have been identified, that should be filled by a systematic study of well-defined quadruplexes not only to provide the basic understanding of stability both for design purposes, but also as it relates to in vivo occurrence of quadruplexes.Quadruplex structures fold and unfold comparatively slowly, and DNA unwinding events associated with transcription and replication may be operating far from equilibrium.The kinetics of formation and resolution of quadruplexes, and methodologies are discussed in the context of stability and their possible biological occurrence.

View Article: PubMed Central - PubMed

Affiliation: Structural Biology Program, JG Brown Cancer Center, University of Louisville, KY 40202, USA. anlane01@gwise.louisville.edu

ABSTRACT
In this review, we give an overview of recent literature on the structure and stability of unimolecular G-rich quadruplex structures that are relevant to drug design and for in vivo function. The unifying theme in this review is energetics. The thermodynamic stability of quadruplexes has not been studied in the same detail as DNA and RNA duplexes, and there are important differences in the balance of forces between these classes of folded oligonucleotides. We provide an overview of the principles of stability and where available the experimental data that report on these principles. Significant gaps in the literature have been identified, that should be filled by a systematic study of well-defined quadruplexes not only to provide the basic understanding of stability both for design purposes, but also as it relates to in vivo occurrence of quadruplexes. Techniques that are commonly applied to the determination of the structure, stability and folding are discussed in terms of information content and limitations. Quadruplex structures fold and unfold comparatively slowly, and DNA unwinding events associated with transcription and replication may be operating far from equilibrium. The kinetics of formation and resolution of quadruplexes, and methodologies are discussed in the context of stability and their possible biological occurrence.

Show MeSH
Observed quadruplex topologies. (A) All ‘parallel’ double chain reversal loops (dA(GGGTTA)3GGG: K+ form) (35), (B) all lateral loops d(GGTTGGTGTGGTTGG) (36), (C) lateral, lateral, double chain reversal loops d(GGGCGCGGGAGGAATTGGGCGGG) (37), (D) double chain reversal, lateral, lateral loops d(TTA(GGGTTA)3GGGA) (38), (E) lateral, diagonal, lateral loops dA(GGGTTA)3GGG (39), (F) diagonal, double chain reversal, diagonal loops (dGGTTTTGGCAGGGTTTTGGT) (40), (G) NMR-derived hybrid 1 (dAAA(GGGTTA)3GGGAA) (41) and (H) the NMR-derived hybrid 2 (dTTA(GGGTTA)3GGGTT) (42). Guanines are shown as green, thymine as blue and adenine as red oblongs.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC2553573&req=5

Figure 3: Observed quadruplex topologies. (A) All ‘parallel’ double chain reversal loops (dA(GGGTTA)3GGG: K+ form) (35), (B) all lateral loops d(GGTTGGTGTGGTTGG) (36), (C) lateral, lateral, double chain reversal loops d(GGGCGCGGGAGGAATTGGGCGGG) (37), (D) double chain reversal, lateral, lateral loops d(TTA(GGGTTA)3GGGA) (38), (E) lateral, diagonal, lateral loops dA(GGGTTA)3GGG (39), (F) diagonal, double chain reversal, diagonal loops (dGGTTTTGGCAGGGTTTTGGT) (40), (G) NMR-derived hybrid 1 (dAAA(GGGTTA)3GGGAA) (41) and (H) the NMR-derived hybrid 2 (dTTA(GGGTTA)3GGGTT) (42). Guanines are shown as green, thymine as blue and adenine as red oblongs.

Mentions: Figure 3 displays some basic topologies. These topologies impose certain constraints in local structures including the syn/anticonformation about the glycosyl bond of the quartet quanines (Figure 1).Figure 3.


Stability and kinetics of G-quadruplex structures.

Lane AN, Chaires JB, Gray RD, Trent JO - Nucleic Acids Res. (2008)

Observed quadruplex topologies. (A) All ‘parallel’ double chain reversal loops (dA(GGGTTA)3GGG: K+ form) (35), (B) all lateral loops d(GGTTGGTGTGGTTGG) (36), (C) lateral, lateral, double chain reversal loops d(GGGCGCGGGAGGAATTGGGCGGG) (37), (D) double chain reversal, lateral, lateral loops d(TTA(GGGTTA)3GGGA) (38), (E) lateral, diagonal, lateral loops dA(GGGTTA)3GGG (39), (F) diagonal, double chain reversal, diagonal loops (dGGTTTTGGCAGGGTTTTGGT) (40), (G) NMR-derived hybrid 1 (dAAA(GGGTTA)3GGGAA) (41) and (H) the NMR-derived hybrid 2 (dTTA(GGGTTA)3GGGTT) (42). Guanines are shown as green, thymine as blue and adenine as red oblongs.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC2553573&req=5

Figure 3: Observed quadruplex topologies. (A) All ‘parallel’ double chain reversal loops (dA(GGGTTA)3GGG: K+ form) (35), (B) all lateral loops d(GGTTGGTGTGGTTGG) (36), (C) lateral, lateral, double chain reversal loops d(GGGCGCGGGAGGAATTGGGCGGG) (37), (D) double chain reversal, lateral, lateral loops d(TTA(GGGTTA)3GGGA) (38), (E) lateral, diagonal, lateral loops dA(GGGTTA)3GGG (39), (F) diagonal, double chain reversal, diagonal loops (dGGTTTTGGCAGGGTTTTGGT) (40), (G) NMR-derived hybrid 1 (dAAA(GGGTTA)3GGGAA) (41) and (H) the NMR-derived hybrid 2 (dTTA(GGGTTA)3GGGTT) (42). Guanines are shown as green, thymine as blue and adenine as red oblongs.
Mentions: Figure 3 displays some basic topologies. These topologies impose certain constraints in local structures including the syn/anticonformation about the glycosyl bond of the quartet quanines (Figure 1).Figure 3.

Bottom Line: Significant gaps in the literature have been identified, that should be filled by a systematic study of well-defined quadruplexes not only to provide the basic understanding of stability both for design purposes, but also as it relates to in vivo occurrence of quadruplexes.Quadruplex structures fold and unfold comparatively slowly, and DNA unwinding events associated with transcription and replication may be operating far from equilibrium.The kinetics of formation and resolution of quadruplexes, and methodologies are discussed in the context of stability and their possible biological occurrence.

View Article: PubMed Central - PubMed

Affiliation: Structural Biology Program, JG Brown Cancer Center, University of Louisville, KY 40202, USA. anlane01@gwise.louisville.edu

ABSTRACT
In this review, we give an overview of recent literature on the structure and stability of unimolecular G-rich quadruplex structures that are relevant to drug design and for in vivo function. The unifying theme in this review is energetics. The thermodynamic stability of quadruplexes has not been studied in the same detail as DNA and RNA duplexes, and there are important differences in the balance of forces between these classes of folded oligonucleotides. We provide an overview of the principles of stability and where available the experimental data that report on these principles. Significant gaps in the literature have been identified, that should be filled by a systematic study of well-defined quadruplexes not only to provide the basic understanding of stability both for design purposes, but also as it relates to in vivo occurrence of quadruplexes. Techniques that are commonly applied to the determination of the structure, stability and folding are discussed in terms of information content and limitations. Quadruplex structures fold and unfold comparatively slowly, and DNA unwinding events associated with transcription and replication may be operating far from equilibrium. The kinetics of formation and resolution of quadruplexes, and methodologies are discussed in the context of stability and their possible biological occurrence.

Show MeSH