Limits...
AcrAB multidrug efflux pump regulation in Salmonella enterica serovar Typhimurium by RamA in response to environmental signals.

Nikaido E, Yamaguchi A, Nishino K - J. Biol. Chem. (2008)

Bottom Line: Among these pumps, AcrAB is effective in generating drug resistance and has wide substrate specificity.Other regulators of acrAB such as MarA, SoxS, Rob, SdiA, and AcrR did not contribute to acrAB induction by indole in Salmonella.Our results suggest that RamA controls the Salmonella AcrAB-TolC multidrug efflux system through dual regulatory modes in response to environmental signals.

View Article: PubMed Central - PubMed

Affiliation: Department of Cell Membrane Biology, Institute of Scientific and Industrial Research, Osaka University, Osaka, Japan.

ABSTRACT
Salmonella enterica serovar Typhimurium has at least nine multidrug efflux pumps. Among these pumps, AcrAB is effective in generating drug resistance and has wide substrate specificity. Here we report that indole, bile, and an Escherichia coli conditioned medium induced the AcrAB pump in Salmonella through a specific regulator, RamA. The RamA-binding sites were located in the upstream regions of acrAB and tolC. RamA was required for indole induction of acrAB. Other regulators of acrAB such as MarA, SoxS, Rob, SdiA, and AcrR did not contribute to acrAB induction by indole in Salmonella. Indole activated ramA transcription, and overproduction of RamA caused increased acrAB expression. In contrast, induction of ramA was not required for induction of acrAB by bile. Cholic acid binds to RamA, and we suggest that bile acts by altering pre-existing RamA. This points to two different AcrAB regulatory modes through RamA. Our results suggest that RamA controls the Salmonella AcrAB-TolC multidrug efflux system through dual regulatory modes in response to environmental signals.

Show MeSH

Related in: MedlinePlus

RamA-binding site for tolC. A, DNA fragments, including tolC promoter regions pTolC1 (-80 to -1; the numbering is relative to the start codon of tolC) and pTolC2 (-100 to +1), were incubated without (-) or with (+) purified RamA (1.0 μm). B, nucleotide sequence upstream region of tolC. Boxed sequence corresponds to the RamA-binding site. The numbers indicate the positions from the start codon of tolC.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC2527123&req=5

fig8: RamA-binding site for tolC. A, DNA fragments, including tolC promoter regions pTolC1 (-80 to -1; the numbering is relative to the start codon of tolC) and pTolC2 (-100 to +1), were incubated without (-) or with (+) purified RamA (1.0 μm). B, nucleotide sequence upstream region of tolC. Boxed sequence corresponds to the RamA-binding site. The numbers indicate the positions from the start codon of tolC.

Mentions: We also determined a RamA-binding site located upstream of tolC. In a tolC promoter, we found a soxbox sequence between -99 and -80 (the numbering is relative to the start codon of tolC). Therefore, we prepared fragments of pTolC1 (-79 to -1) and pTolC2 (-99 to -1) to determine binding location. RamA bound to pTolC2 but did not bind to pTolC1 (Fig. 8A) indicating that RamA binds between -99 to -80 and contains the ATGGCACGTAACGCCAACTT consensus sequence (Fig. 8B).


AcrAB multidrug efflux pump regulation in Salmonella enterica serovar Typhimurium by RamA in response to environmental signals.

Nikaido E, Yamaguchi A, Nishino K - J. Biol. Chem. (2008)

RamA-binding site for tolC. A, DNA fragments, including tolC promoter regions pTolC1 (-80 to -1; the numbering is relative to the start codon of tolC) and pTolC2 (-100 to +1), were incubated without (-) or with (+) purified RamA (1.0 μm). B, nucleotide sequence upstream region of tolC. Boxed sequence corresponds to the RamA-binding site. The numbers indicate the positions from the start codon of tolC.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC2527123&req=5

fig8: RamA-binding site for tolC. A, DNA fragments, including tolC promoter regions pTolC1 (-80 to -1; the numbering is relative to the start codon of tolC) and pTolC2 (-100 to +1), were incubated without (-) or with (+) purified RamA (1.0 μm). B, nucleotide sequence upstream region of tolC. Boxed sequence corresponds to the RamA-binding site. The numbers indicate the positions from the start codon of tolC.
Mentions: We also determined a RamA-binding site located upstream of tolC. In a tolC promoter, we found a soxbox sequence between -99 and -80 (the numbering is relative to the start codon of tolC). Therefore, we prepared fragments of pTolC1 (-79 to -1) and pTolC2 (-99 to -1) to determine binding location. RamA bound to pTolC2 but did not bind to pTolC1 (Fig. 8A) indicating that RamA binds between -99 to -80 and contains the ATGGCACGTAACGCCAACTT consensus sequence (Fig. 8B).

Bottom Line: Among these pumps, AcrAB is effective in generating drug resistance and has wide substrate specificity.Other regulators of acrAB such as MarA, SoxS, Rob, SdiA, and AcrR did not contribute to acrAB induction by indole in Salmonella.Our results suggest that RamA controls the Salmonella AcrAB-TolC multidrug efflux system through dual regulatory modes in response to environmental signals.

View Article: PubMed Central - PubMed

Affiliation: Department of Cell Membrane Biology, Institute of Scientific and Industrial Research, Osaka University, Osaka, Japan.

ABSTRACT
Salmonella enterica serovar Typhimurium has at least nine multidrug efflux pumps. Among these pumps, AcrAB is effective in generating drug resistance and has wide substrate specificity. Here we report that indole, bile, and an Escherichia coli conditioned medium induced the AcrAB pump in Salmonella through a specific regulator, RamA. The RamA-binding sites were located in the upstream regions of acrAB and tolC. RamA was required for indole induction of acrAB. Other regulators of acrAB such as MarA, SoxS, Rob, SdiA, and AcrR did not contribute to acrAB induction by indole in Salmonella. Indole activated ramA transcription, and overproduction of RamA caused increased acrAB expression. In contrast, induction of ramA was not required for induction of acrAB by bile. Cholic acid binds to RamA, and we suggest that bile acts by altering pre-existing RamA. This points to two different AcrAB regulatory modes through RamA. Our results suggest that RamA controls the Salmonella AcrAB-TolC multidrug efflux system through dual regulatory modes in response to environmental signals.

Show MeSH
Related in: MedlinePlus