Limits...
AcrAB multidrug efflux pump regulation in Salmonella enterica serovar Typhimurium by RamA in response to environmental signals.

Nikaido E, Yamaguchi A, Nishino K - J. Biol. Chem. (2008)

Bottom Line: Among these pumps, AcrAB is effective in generating drug resistance and has wide substrate specificity.Other regulators of acrAB such as MarA, SoxS, Rob, SdiA, and AcrR did not contribute to acrAB induction by indole in Salmonella.Our results suggest that RamA controls the Salmonella AcrAB-TolC multidrug efflux system through dual regulatory modes in response to environmental signals.

View Article: PubMed Central - PubMed

Affiliation: Department of Cell Membrane Biology, Institute of Scientific and Industrial Research, Osaka University, Osaka, Japan.

ABSTRACT
Salmonella enterica serovar Typhimurium has at least nine multidrug efflux pumps. Among these pumps, AcrAB is effective in generating drug resistance and has wide substrate specificity. Here we report that indole, bile, and an Escherichia coli conditioned medium induced the AcrAB pump in Salmonella through a specific regulator, RamA. The RamA-binding sites were located in the upstream regions of acrAB and tolC. RamA was required for indole induction of acrAB. Other regulators of acrAB such as MarA, SoxS, Rob, SdiA, and AcrR did not contribute to acrAB induction by indole in Salmonella. Indole activated ramA transcription, and overproduction of RamA caused increased acrAB expression. In contrast, induction of ramA was not required for induction of acrAB by bile. Cholic acid binds to RamA, and we suggest that bile acts by altering pre-existing RamA. This points to two different AcrAB regulatory modes through RamA. Our results suggest that RamA controls the Salmonella AcrAB-TolC multidrug efflux system through dual regulatory modes in response to environmental signals.

Show MeSH

Related in: MedlinePlus

A-C, determination of RamA-binding site for acrA. EMSA of RamA binding to the upstream regions of acrA is shown. DNA fragments, including upstream regions of acrA, were incubated without (-) or with (+) purified RamA (1.0 μm). DNA fragments are as follows: pAcr2 (-141 to +16, the numbering is relative to the start codon of acrA), pAcrA3 (-241 to +16), pAcrA4 (-341 to +16), pAcrA5 (-441 to +16), pAcrA6 (-541 to +16), pAcrA7 (-641 to +16) (A), pAcrA8 (-191 to +16) (B), pAcrA9 (-151 to +16), pAcrA10 (-161 to +16), pAcrA11 (-171 to +16), and pAcrA12 (-181 to +16) (C). D, nucleotide sequence in the upstream region of acrA. Boxed sequence corresponds to the RamA-binding site. The numbers indicate the positions from the start codon of acrA.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC2527123&req=5

fig7: A-C, determination of RamA-binding site for acrA. EMSA of RamA binding to the upstream regions of acrA is shown. DNA fragments, including upstream regions of acrA, were incubated without (-) or with (+) purified RamA (1.0 μm). DNA fragments are as follows: pAcr2 (-141 to +16, the numbering is relative to the start codon of acrA), pAcrA3 (-241 to +16), pAcrA4 (-341 to +16), pAcrA5 (-441 to +16), pAcrA6 (-541 to +16), pAcrA7 (-641 to +16) (A), pAcrA8 (-191 to +16) (B), pAcrA9 (-151 to +16), pAcrA10 (-161 to +16), pAcrA11 (-171 to +16), and pAcrA12 (-181 to +16) (C). D, nucleotide sequence in the upstream region of acrA. Boxed sequence corresponds to the RamA-binding site. The numbers indicate the positions from the start codon of acrA.

Mentions: Determination of RamA-binding Sites for acrA and tolC—To determine the RamA-binding site for acrA, we prepared different lengths of DNA fragments for EMSA. The fragments used were as follows: pAcrA3 (-241 to +16, the numbering is relative to the start codon of acrA), pAcrA4 (-341 to +16), pAcrA5 (-441 to +16), pAcrA6 (-541 to +16), and pAcrA7 (-641 to +16). RamA bound to pAcrA3-7, but it did not bind to pAcr2 (Fig. 7A). These results indicate that the RamA-binding site was between -241 and -142. We then examined fragment pAcrA8 (-191 to +16); RamA bound to this fragment, indicating a binding site between -191 and -142 (Fig. 7B). Further examination with pAcrA9 (-151 to +16), pAcrA10 (-161 to +16), pAcrA11 (-171 to +16), and pAcrA12 (-181 to +16) revealed that RamA bound to pAcrA10-12 but not to pAcrA9 (Fig. 7C). These results indicate that the -161 to -152-bp region is required for RamA binding. It was previously reported that RamA bound to a 20-bp asymmetric sequence with a degenerate consensus soxbox of AYNGCAC-NNWNNRYYAAAYN (N = any base; R = A/G; W = A/T; Y = C/T) (50, 51). A DNA sequence resembling this consensus soxbox sequence, ATGGCACGAAAAACCAAACA, was located at -161 to -142 (Fig. 7D).


AcrAB multidrug efflux pump regulation in Salmonella enterica serovar Typhimurium by RamA in response to environmental signals.

Nikaido E, Yamaguchi A, Nishino K - J. Biol. Chem. (2008)

A-C, determination of RamA-binding site for acrA. EMSA of RamA binding to the upstream regions of acrA is shown. DNA fragments, including upstream regions of acrA, were incubated without (-) or with (+) purified RamA (1.0 μm). DNA fragments are as follows: pAcr2 (-141 to +16, the numbering is relative to the start codon of acrA), pAcrA3 (-241 to +16), pAcrA4 (-341 to +16), pAcrA5 (-441 to +16), pAcrA6 (-541 to +16), pAcrA7 (-641 to +16) (A), pAcrA8 (-191 to +16) (B), pAcrA9 (-151 to +16), pAcrA10 (-161 to +16), pAcrA11 (-171 to +16), and pAcrA12 (-181 to +16) (C). D, nucleotide sequence in the upstream region of acrA. Boxed sequence corresponds to the RamA-binding site. The numbers indicate the positions from the start codon of acrA.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC2527123&req=5

fig7: A-C, determination of RamA-binding site for acrA. EMSA of RamA binding to the upstream regions of acrA is shown. DNA fragments, including upstream regions of acrA, were incubated without (-) or with (+) purified RamA (1.0 μm). DNA fragments are as follows: pAcr2 (-141 to +16, the numbering is relative to the start codon of acrA), pAcrA3 (-241 to +16), pAcrA4 (-341 to +16), pAcrA5 (-441 to +16), pAcrA6 (-541 to +16), pAcrA7 (-641 to +16) (A), pAcrA8 (-191 to +16) (B), pAcrA9 (-151 to +16), pAcrA10 (-161 to +16), pAcrA11 (-171 to +16), and pAcrA12 (-181 to +16) (C). D, nucleotide sequence in the upstream region of acrA. Boxed sequence corresponds to the RamA-binding site. The numbers indicate the positions from the start codon of acrA.
Mentions: Determination of RamA-binding Sites for acrA and tolC—To determine the RamA-binding site for acrA, we prepared different lengths of DNA fragments for EMSA. The fragments used were as follows: pAcrA3 (-241 to +16, the numbering is relative to the start codon of acrA), pAcrA4 (-341 to +16), pAcrA5 (-441 to +16), pAcrA6 (-541 to +16), and pAcrA7 (-641 to +16). RamA bound to pAcrA3-7, but it did not bind to pAcr2 (Fig. 7A). These results indicate that the RamA-binding site was between -241 and -142. We then examined fragment pAcrA8 (-191 to +16); RamA bound to this fragment, indicating a binding site between -191 and -142 (Fig. 7B). Further examination with pAcrA9 (-151 to +16), pAcrA10 (-161 to +16), pAcrA11 (-171 to +16), and pAcrA12 (-181 to +16) revealed that RamA bound to pAcrA10-12 but not to pAcrA9 (Fig. 7C). These results indicate that the -161 to -152-bp region is required for RamA binding. It was previously reported that RamA bound to a 20-bp asymmetric sequence with a degenerate consensus soxbox of AYNGCAC-NNWNNRYYAAAYN (N = any base; R = A/G; W = A/T; Y = C/T) (50, 51). A DNA sequence resembling this consensus soxbox sequence, ATGGCACGAAAAACCAAACA, was located at -161 to -142 (Fig. 7D).

Bottom Line: Among these pumps, AcrAB is effective in generating drug resistance and has wide substrate specificity.Other regulators of acrAB such as MarA, SoxS, Rob, SdiA, and AcrR did not contribute to acrAB induction by indole in Salmonella.Our results suggest that RamA controls the Salmonella AcrAB-TolC multidrug efflux system through dual regulatory modes in response to environmental signals.

View Article: PubMed Central - PubMed

Affiliation: Department of Cell Membrane Biology, Institute of Scientific and Industrial Research, Osaka University, Osaka, Japan.

ABSTRACT
Salmonella enterica serovar Typhimurium has at least nine multidrug efflux pumps. Among these pumps, AcrAB is effective in generating drug resistance and has wide substrate specificity. Here we report that indole, bile, and an Escherichia coli conditioned medium induced the AcrAB pump in Salmonella through a specific regulator, RamA. The RamA-binding sites were located in the upstream regions of acrAB and tolC. RamA was required for indole induction of acrAB. Other regulators of acrAB such as MarA, SoxS, Rob, SdiA, and AcrR did not contribute to acrAB induction by indole in Salmonella. Indole activated ramA transcription, and overproduction of RamA caused increased acrAB expression. In contrast, induction of ramA was not required for induction of acrAB by bile. Cholic acid binds to RamA, and we suggest that bile acts by altering pre-existing RamA. This points to two different AcrAB regulatory modes through RamA. Our results suggest that RamA controls the Salmonella AcrAB-TolC multidrug efflux system through dual regulatory modes in response to environmental signals.

Show MeSH
Related in: MedlinePlus