Limits...
Genomic organization, expression, and analysis of the troponin C gene pat-10 of Caenorhabditis elegans.

Terami H, Williams BD, Kitamura Si, Sakube Y, Matsumoto S, Doi S, Obinata T, Kagawa H - J. Cell Biol. (1999)

Bottom Line: We have sequenced two of the mutations in pat-10 and both had identical two mutations in the gene; one changes D64 to N and the other changes W153 to a termination site.The missense alteration affects a calcium-binding site and eliminates calcium binding, whereas the second mutation eliminates binding to troponin I.These combined biochemical and in vivo studies of mutant animals demonstrate that this troponin is essential for proper muscle function during development.

View Article: PubMed Central - PubMed

Affiliation: Department of Biology, Faculty of Science, Okayama University, Okayama, 700-8530 Japan.

ABSTRACT
We have cloned and characterized the troponin C gene, pat-10 of the nematode Caenorhabditis elegans. At the amino acid level nematode troponin C is most similar to troponin C of Drosophila (45% identity) and cardiac troponin C of vertebrates. Expression studies demonstrate that this troponin is expressed in body wall muscle throughout the life of the animal. Later, vulval muscles and anal muscles also express this troponin C isoform. The structural gene for this troponin is pat-10 and mutations in this gene lead to animals that arrest as twofold paralyzed embryos late in development. We have sequenced two of the mutations in pat-10 and both had identical two mutations in the gene; one changes D64 to N and the other changes W153 to a termination site. The missense alteration affects a calcium-binding site and eliminates calcium binding, whereas the second mutation eliminates binding to troponin I. These combined biochemical and in vivo studies of mutant animals demonstrate that this troponin is essential for proper muscle function during development.

Show MeSH
Nucleotide sequence of the troponin C gene pat-10. The exons have been translated using the standard one letter code. The splicing pattern of the gene is given in Fig. 1 D. Mutation sites in pat-10(st575) animal are shown on the top of the sequence at G1860A and G2179A. Restriction sites and the positions of primers for mutation sites determination are indicated. The accession number of pat-10 sequence in the GSDB, DDBJ, EMBL, and NCBI is D45895.
© Copyright Policy
Related In: Results  -  Collection


getmorefigures.php?uid=PMC2199735&req=5

Figure 2: Nucleotide sequence of the troponin C gene pat-10. The exons have been translated using the standard one letter code. The splicing pattern of the gene is given in Fig. 1 D. Mutation sites in pat-10(st575) animal are shown on the top of the sequence at G1860A and G2179A. Restriction sites and the positions of primers for mutation sites determination are indicated. The accession number of pat-10 sequence in the GSDB, DDBJ, EMBL, and NCBI is D45895.

Mentions: Placement of tnc-1 on the physical map of the chromosome was essentially the same as described previously (Coulson et al. 1988). PCR products for determining pat-10 mutation sites in tnc-1 used the following oligonucleotides as upstream primers: TNCS1 (AGCCTTGTCTCTCGAATCCTGTGT), TNCS2 (GCTGAGGATATCGAAGAGATTCTTG), TNCS3 (ATCTATGTGGCATCTAACTTCATTC), and the oligonucleotides: TNCA3 (CCTCAATTTGGGATCCGTCGAT), TNCA1 (TGCGGATCAGTTTACGAAGGGTCT), and TNCA2 (GTTGGTGACTGGTCCCCACAGTTGA) as downstream primers, respectively (see Fig. 2), and total DNA from st575 and st568 as templates. Three PCR fragments were cloned into pBluescript SK(−) vectors and were sequenced by designed primers. 30 cycles for reactions were 95°C for 30 s, 55°C for 1 min, and 72°C for 1 min. 5′ RACE1 was done by two steps with the protocol of GIBCO BRL (Gaithersburg, MD). At the first step cDNA was synthesized by using the oligonucleotides TNCA1 and total RNA as a template. The second step PCR was done by using the anchor oligonucleotide as an upstream primer and TNCA3 as a downstream primer and purified cDNA fragment as a template. Forty cycles for 5′ RACE were 95°C for 30 s, 50°C for 1 min, and 72°C for 1 min.


Genomic organization, expression, and analysis of the troponin C gene pat-10 of Caenorhabditis elegans.

Terami H, Williams BD, Kitamura Si, Sakube Y, Matsumoto S, Doi S, Obinata T, Kagawa H - J. Cell Biol. (1999)

Nucleotide sequence of the troponin C gene pat-10. The exons have been translated using the standard one letter code. The splicing pattern of the gene is given in Fig. 1 D. Mutation sites in pat-10(st575) animal are shown on the top of the sequence at G1860A and G2179A. Restriction sites and the positions of primers for mutation sites determination are indicated. The accession number of pat-10 sequence in the GSDB, DDBJ, EMBL, and NCBI is D45895.
© Copyright Policy
Related In: Results  -  Collection

Show All Figures
getmorefigures.php?uid=PMC2199735&req=5

Figure 2: Nucleotide sequence of the troponin C gene pat-10. The exons have been translated using the standard one letter code. The splicing pattern of the gene is given in Fig. 1 D. Mutation sites in pat-10(st575) animal are shown on the top of the sequence at G1860A and G2179A. Restriction sites and the positions of primers for mutation sites determination are indicated. The accession number of pat-10 sequence in the GSDB, DDBJ, EMBL, and NCBI is D45895.
Mentions: Placement of tnc-1 on the physical map of the chromosome was essentially the same as described previously (Coulson et al. 1988). PCR products for determining pat-10 mutation sites in tnc-1 used the following oligonucleotides as upstream primers: TNCS1 (AGCCTTGTCTCTCGAATCCTGTGT), TNCS2 (GCTGAGGATATCGAAGAGATTCTTG), TNCS3 (ATCTATGTGGCATCTAACTTCATTC), and the oligonucleotides: TNCA3 (CCTCAATTTGGGATCCGTCGAT), TNCA1 (TGCGGATCAGTTTACGAAGGGTCT), and TNCA2 (GTTGGTGACTGGTCCCCACAGTTGA) as downstream primers, respectively (see Fig. 2), and total DNA from st575 and st568 as templates. Three PCR fragments were cloned into pBluescript SK(−) vectors and were sequenced by designed primers. 30 cycles for reactions were 95°C for 30 s, 55°C for 1 min, and 72°C for 1 min. 5′ RACE1 was done by two steps with the protocol of GIBCO BRL (Gaithersburg, MD). At the first step cDNA was synthesized by using the oligonucleotides TNCA1 and total RNA as a template. The second step PCR was done by using the anchor oligonucleotide as an upstream primer and TNCA3 as a downstream primer and purified cDNA fragment as a template. Forty cycles for 5′ RACE were 95°C for 30 s, 50°C for 1 min, and 72°C for 1 min.

Bottom Line: We have sequenced two of the mutations in pat-10 and both had identical two mutations in the gene; one changes D64 to N and the other changes W153 to a termination site.The missense alteration affects a calcium-binding site and eliminates calcium binding, whereas the second mutation eliminates binding to troponin I.These combined biochemical and in vivo studies of mutant animals demonstrate that this troponin is essential for proper muscle function during development.

View Article: PubMed Central - PubMed

Affiliation: Department of Biology, Faculty of Science, Okayama University, Okayama, 700-8530 Japan.

ABSTRACT
We have cloned and characterized the troponin C gene, pat-10 of the nematode Caenorhabditis elegans. At the amino acid level nematode troponin C is most similar to troponin C of Drosophila (45% identity) and cardiac troponin C of vertebrates. Expression studies demonstrate that this troponin is expressed in body wall muscle throughout the life of the animal. Later, vulval muscles and anal muscles also express this troponin C isoform. The structural gene for this troponin is pat-10 and mutations in this gene lead to animals that arrest as twofold paralyzed embryos late in development. We have sequenced two of the mutations in pat-10 and both had identical two mutations in the gene; one changes D64 to N and the other changes W153 to a termination site. The missense alteration affects a calcium-binding site and eliminates calcium binding, whereas the second mutation eliminates binding to troponin I. These combined biochemical and in vivo studies of mutant animals demonstrate that this troponin is essential for proper muscle function during development.

Show MeSH