Limits...
Follicular dendritic cells specifically express the long CR2/CD21 isoform.

Liu YJ, Xu J, de Bouteiller O, Parham CL, Grouard G, Djossou O, de Saint-Vis B, Lebecque S, Banchereau J, Moore KW - J. Exp. Med. (1997)

Bottom Line: By expression cloning, a cDNA clone encoding for the long human CR2/ CD21 isoform (CD21L) that contains an additional exon (10a) was isolated.We demonstrated that FDCs selectively express CD21L, while B cells selectively express the short CR2/CD21 lacking exon 10a (CD21S).Thus, CD21L represents the first characterized human FDC-specific molecule, which may confer unique functions of FDCs in germinal center development.

View Article: PubMed Central - PubMed

Affiliation: Schering-Plough, Laboratory for Immunological Research, Dardilly, France.

ABSTRACT
This paper describes an antibody (mAb 7D6) that specifically recognizes human follicular dendritic cells (FDCs). By expression cloning, a cDNA clone encoding for the long human CR2/ CD21 isoform (CD21L) that contains an additional exon (10a) was isolated. We demonstrated that FDCs selectively express CD21L, while B cells selectively express the short CR2/CD21 lacking exon 10a (CD21S). By screening mouse Ltk- cells transfected with the CD21L cDNA, we further showed that the other two anti-human FDC mAbs DRC-1 and KiM4 also recognize CD21L. Thus, CD21L represents the first characterized human FDC-specific molecule, which may confer unique functions of FDCs in germinal center development.

Show MeSH
Diagrams of CD21S and CD21L and their detection by  PCR assay. This figure is made according to Ahearn and Fearon (30).  Boxes represent the short consensus repeats (SCRs). 15 (CD21S) and 16  (CD21L) SCRs are grouped into four long homologous repeats indicated  by four different intensities of background. SCR10a is present in CD21L  but not in CD21S. The PCR was performed using: (a) a 5′ primer starting at bp 1,704 within the CD21S cDNA sequence, covering part of the  coding region of SCR10 (5′ GGAGAGAGCACCATCCGTTG); and (b)  a 3′ primer starting at position 2363 within the coding region of SCR11  (3′ GGGCAGCGAGTCACAGGAGGAG). Accordingly, the predicted  PCR products derived from CD21S and CD21L mRNA should be 659  and 736 bp, respectively.
© Copyright Policy
Related In: Results  -  Collection


getmorefigures.php?uid=PMC2196095&req=5

Figure 2: Diagrams of CD21S and CD21L and their detection by PCR assay. This figure is made according to Ahearn and Fearon (30). Boxes represent the short consensus repeats (SCRs). 15 (CD21S) and 16 (CD21L) SCRs are grouped into four long homologous repeats indicated by four different intensities of background. SCR10a is present in CD21L but not in CD21S. The PCR was performed using: (a) a 5′ primer starting at bp 1,704 within the CD21S cDNA sequence, covering part of the coding region of SCR10 (5′ GGAGAGAGCACCATCCGTTG); and (b) a 3′ primer starting at position 2363 within the coding region of SCR11 (3′ GGGCAGCGAGTCACAGGAGGAG). Accordingly, the predicted PCR products derived from CD21S and CD21L mRNA should be 659 and 736 bp, respectively.

Mentions: mRNA was extracted from 104 FDC purified by FACS® sorting according to their high expression of CD21 and CD14 antigens. cDNA was obtained by reverse transcription (Superscript Reverse Transcriptase Kit; GIBCO BRL). PCR assay was performed using a 5′ primer UHCR2-1704 (GGAGAGAGCACCATCCGTTG), a 3′ primer ULCR2-2363 (GGGCAGCGAGTCACAGGAGGAG) (see Fig. 2), and a taq polymerase (Perkin-Elmer Corp., Norwalk, CT) in a thermal cycler. The first cycle of denaturation was at 94°C for 3 min, and then 35 cycles including 1 min of denaturation at 94°C, 2 min for primer annealing at 60°C, and 3 min of extension at 72°C. Complete extension was achieved for 10 min at 72°C. PCR products were loaded on a 1% low melting point gel for purification (WIZARD PCR DNA Purification System; Promega Biotec, Madison, WI). These products were ligated and cloned in the PCRtmII vector with TA cloning kit (Invitrogen, San Diego, CA). Plasmids were extracted from individual bacterial colonies and both strands were sequenced on an automated DNA sequencer (Applied Biosystems) using PCR II vector primers (21 M13, and M13RP).


Follicular dendritic cells specifically express the long CR2/CD21 isoform.

Liu YJ, Xu J, de Bouteiller O, Parham CL, Grouard G, Djossou O, de Saint-Vis B, Lebecque S, Banchereau J, Moore KW - J. Exp. Med. (1997)

Diagrams of CD21S and CD21L and their detection by  PCR assay. This figure is made according to Ahearn and Fearon (30).  Boxes represent the short consensus repeats (SCRs). 15 (CD21S) and 16  (CD21L) SCRs are grouped into four long homologous repeats indicated  by four different intensities of background. SCR10a is present in CD21L  but not in CD21S. The PCR was performed using: (a) a 5′ primer starting at bp 1,704 within the CD21S cDNA sequence, covering part of the  coding region of SCR10 (5′ GGAGAGAGCACCATCCGTTG); and (b)  a 3′ primer starting at position 2363 within the coding region of SCR11  (3′ GGGCAGCGAGTCACAGGAGGAG). Accordingly, the predicted  PCR products derived from CD21S and CD21L mRNA should be 659  and 736 bp, respectively.
© Copyright Policy
Related In: Results  -  Collection

Show All Figures
getmorefigures.php?uid=PMC2196095&req=5

Figure 2: Diagrams of CD21S and CD21L and their detection by PCR assay. This figure is made according to Ahearn and Fearon (30). Boxes represent the short consensus repeats (SCRs). 15 (CD21S) and 16 (CD21L) SCRs are grouped into four long homologous repeats indicated by four different intensities of background. SCR10a is present in CD21L but not in CD21S. The PCR was performed using: (a) a 5′ primer starting at bp 1,704 within the CD21S cDNA sequence, covering part of the coding region of SCR10 (5′ GGAGAGAGCACCATCCGTTG); and (b) a 3′ primer starting at position 2363 within the coding region of SCR11 (3′ GGGCAGCGAGTCACAGGAGGAG). Accordingly, the predicted PCR products derived from CD21S and CD21L mRNA should be 659 and 736 bp, respectively.
Mentions: mRNA was extracted from 104 FDC purified by FACS® sorting according to their high expression of CD21 and CD14 antigens. cDNA was obtained by reverse transcription (Superscript Reverse Transcriptase Kit; GIBCO BRL). PCR assay was performed using a 5′ primer UHCR2-1704 (GGAGAGAGCACCATCCGTTG), a 3′ primer ULCR2-2363 (GGGCAGCGAGTCACAGGAGGAG) (see Fig. 2), and a taq polymerase (Perkin-Elmer Corp., Norwalk, CT) in a thermal cycler. The first cycle of denaturation was at 94°C for 3 min, and then 35 cycles including 1 min of denaturation at 94°C, 2 min for primer annealing at 60°C, and 3 min of extension at 72°C. Complete extension was achieved for 10 min at 72°C. PCR products were loaded on a 1% low melting point gel for purification (WIZARD PCR DNA Purification System; Promega Biotec, Madison, WI). These products were ligated and cloned in the PCRtmII vector with TA cloning kit (Invitrogen, San Diego, CA). Plasmids were extracted from individual bacterial colonies and both strands were sequenced on an automated DNA sequencer (Applied Biosystems) using PCR II vector primers (21 M13, and M13RP).

Bottom Line: By expression cloning, a cDNA clone encoding for the long human CR2/ CD21 isoform (CD21L) that contains an additional exon (10a) was isolated.We demonstrated that FDCs selectively express CD21L, while B cells selectively express the short CR2/CD21 lacking exon 10a (CD21S).Thus, CD21L represents the first characterized human FDC-specific molecule, which may confer unique functions of FDCs in germinal center development.

View Article: PubMed Central - PubMed

Affiliation: Schering-Plough, Laboratory for Immunological Research, Dardilly, France.

ABSTRACT
This paper describes an antibody (mAb 7D6) that specifically recognizes human follicular dendritic cells (FDCs). By expression cloning, a cDNA clone encoding for the long human CR2/ CD21 isoform (CD21L) that contains an additional exon (10a) was isolated. We demonstrated that FDCs selectively express CD21L, while B cells selectively express the short CR2/CD21 lacking exon 10a (CD21S). By screening mouse Ltk- cells transfected with the CD21L cDNA, we further showed that the other two anti-human FDC mAbs DRC-1 and KiM4 also recognize CD21L. Thus, CD21L represents the first characterized human FDC-specific molecule, which may confer unique functions of FDCs in germinal center development.

Show MeSH