Limits...
CD80 (B7-1) binds both CD28 and CTLA-4 with a low affinity and very fast kinetics.

van der Merwe PA, Bodian DL, Daenke S, Linsley P, Davis SJ - J. Exp. Med. (1997)

Bottom Line: Preliminary reports have suggested that CD80 binds CTLA-4 and CD28 with affinities (Kd values approximately 12 and approximately 200 nM, respectively) that are high when compared with other molecular interactions that contribute to T cell-APC recognition.In the present study, we use surface plasmon resonance to measure the affinity and kinetics of CD80 binding to CD28 and CTLA-4.At 37 degrees C, soluble recombinant CD80 bound to CTLA-4 and CD28 with Kd values of 0.42 and 4 microM, respectively.

View Article: PubMed Central - PubMed

Affiliation: Medical Research Council Cellular Immunology Unit, Sir William Dunn School of Pathology, University of Oxford, United Kingdom.

ABSTRACT
The structurally related T cell surface molecules CD28 and CTLA-4 interact with cell surface ligands CD80 (B7-1) and CD86 (B7-2) on antigen-presenting cells (APC) and modulate T cell antigen recognition. Preliminary reports have suggested that CD80 binds CTLA-4 and CD28 with affinities (Kd values approximately 12 and approximately 200 nM, respectively) that are high when compared with other molecular interactions that contribute to T cell-APC recognition. In the present study, we use surface plasmon resonance to measure the affinity and kinetics of CD80 binding to CD28 and CTLA-4. At 37 degrees C, soluble recombinant CD80 bound to CTLA-4 and CD28 with Kd values of 0.42 and 4 microM, respectively. Kinetic analysis indicated that these low affinities were the result of very fast dissociation rate constants (k(off)); sCD80 dissociated from CD28 and CTLA-4 with k(off) values of > or = 1.6 and > or = 0.43 s-1, respectively. Such rapid binding kinetics have also been reported for the T cell adhesion molecule CD2 and may be necessary to accommodate-dynamic T cell-APC contacts and to facilitate scanning of APC for antigen.

Show MeSH

Related in: MedlinePlus

Biochemical analysis of sCD80 and CTLA-4 Ig. (A) sCD80  and CTLA-4 Ig (2.5 μg each) were analyzed by SDS-PAGE on 10%  acrylamide under nonreducing and reducing (+βME) conditions. The  migration positions of the indicated (in kD) molecular mass markers are  shown. (B) Measuring the binding activity of sCD80. Protein A–sepharose  beads coated with CTLA-4 Ig or CD22 Ig were incubated with soluble  sCD80, pelleted, and the supernatant analyzed for the presence of sCD80  by reducing SDS-PAGE on 12% acrylamide, together with sCD80 not  exposed to beads (Control). (C) Analysis of sCD80 by size-exclusion chromatography. sCD80 (2.1 mg in 0.5 ml) was run on a SUPERDEX S200  HR10/30 column (Pharmacia) at 0.5 ml/min. The calibration markers  shown (Sigma) were alcohol dehydrogenase (Mr 150,000), BSA (Mr  66,000), and carbonic anhydrase (Mr 29,000). sCD48–CD4 and sCD2 are  described in the text.
© Copyright Policy
Related In: Results  -  Collection


getmorefigures.php?uid=PMC2196039&req=5

Figure 1: Biochemical analysis of sCD80 and CTLA-4 Ig. (A) sCD80 and CTLA-4 Ig (2.5 μg each) were analyzed by SDS-PAGE on 10% acrylamide under nonreducing and reducing (+βME) conditions. The migration positions of the indicated (in kD) molecular mass markers are shown. (B) Measuring the binding activity of sCD80. Protein A–sepharose beads coated with CTLA-4 Ig or CD22 Ig were incubated with soluble sCD80, pelleted, and the supernatant analyzed for the presence of sCD80 by reducing SDS-PAGE on 12% acrylamide, together with sCD80 not exposed to beads (Control). (C) Analysis of sCD80 by size-exclusion chromatography. sCD80 (2.1 mg in 0.5 ml) was run on a SUPERDEX S200 HR10/30 column (Pharmacia) at 0.5 ml/min. The calibration markers shown (Sigma) were alcohol dehydrogenase (Mr 150,000), BSA (Mr 66,000), and carbonic anhydrase (Mr 29,000). sCD48–CD4 and sCD2 are described in the text.

Mentions: The soluble CD80 construct was designed to encode the extracellular portion of CD80 up to lysine-209 followed by a carboxy-terminal oligo-histidine tag for purification (sCD80his). It was made by PCR using cDNA from MT-2 cells (HTLV-1-transformed human T cells) as template. The 5′ primer TAGTAGAAGCTTTCCCCATCCGCTCAAGCAGGCCACCATGGGCCACACACGGAGG was complementary to the CD80 leader sequence but added an HindIII site and inserted, immediately upstream of the initiation codon, the 25 bases that precede the rat CD4 initiation codon (41). The 3′ primer TAGTAGTCTAGACTAATGATGATGATGATGATGCTTGGCTGTATTCCAGTTGAAGGT added six histidine residues and a stop codon after lysine 209, mutated threonine 208 to alanine to remove a potential NH2-linked glycosylation site, and added a XbaI site. The 10 carboxy-terminal amino acids of sCD80his were thus NTAKHHHHHH. The resulting PCR fragment was subcloned into the glutamine synthetase expression vector pEE14 (39) using its XbaI and HindIII restriction sites, and the sequence was confirmed by dideoxy sequencing. CHO-K1 cells were transfected as described (38, 39) with the sCD80hisencoding plasmid by calcium phosphate transfection. Clones expressing high levels of sCD80his (∼40 mg/L) were identified by growth in the presence of [35S]methionine/[35S]cysteine (TRANS35SLABEL; ICN Pharmaceuticals, Costa Mesa, CA), purification of labeled protein from the culture supernatant using Ni-NTA spin columns (Qiagen GmbH, Hilden, Federal Republic of Germany), and then SDS-PAGE of the protein followed by autoradiography. The best clone was grown up to confluence in bulk culture before switching to serum-free medium supplemented with 2 mM Na butyrate. sCD80his was purified by affinity chromatography using Ni-NTA resin (Qiagen GmbH) followed by size-exclusion chromatography on a SUPERDEX S200 HR10/30 column. The extinction coefficient (at 280 nm) of sCD80his was determined by amino acid analysis to be 1.41 ml.mg−1. The carboxy-terminal his tag was cleaved off by incubating 2.5 mg of sCD80his in 1.5 ml Tris–saline buffer (140 mM NaCl, 10 mM Tris [pH 7.5]) with 1.2 U of carboxypeptidase A conjugated to agarose beads (Sigma Chemical, Poole, UK) for 16 h at 30°C with agitation. Amino acid analysis confirmed that ⩾90% of the carboxy-terminal histidine residues (5.4 molecules per sCD80his molecule), but no other amino acids, were released during this incubation (data not shown). The carboxypeptidase A was removed by centrifugation and the digested sCD80his (sCD80) was repurified on a SUPERDEX S200 HR10/30 column (Fig. 1 C).


CD80 (B7-1) binds both CD28 and CTLA-4 with a low affinity and very fast kinetics.

van der Merwe PA, Bodian DL, Daenke S, Linsley P, Davis SJ - J. Exp. Med. (1997)

Biochemical analysis of sCD80 and CTLA-4 Ig. (A) sCD80  and CTLA-4 Ig (2.5 μg each) were analyzed by SDS-PAGE on 10%  acrylamide under nonreducing and reducing (+βME) conditions. The  migration positions of the indicated (in kD) molecular mass markers are  shown. (B) Measuring the binding activity of sCD80. Protein A–sepharose  beads coated with CTLA-4 Ig or CD22 Ig were incubated with soluble  sCD80, pelleted, and the supernatant analyzed for the presence of sCD80  by reducing SDS-PAGE on 12% acrylamide, together with sCD80 not  exposed to beads (Control). (C) Analysis of sCD80 by size-exclusion chromatography. sCD80 (2.1 mg in 0.5 ml) was run on a SUPERDEX S200  HR10/30 column (Pharmacia) at 0.5 ml/min. The calibration markers  shown (Sigma) were alcohol dehydrogenase (Mr 150,000), BSA (Mr  66,000), and carbonic anhydrase (Mr 29,000). sCD48–CD4 and sCD2 are  described in the text.
© Copyright Policy
Related In: Results  -  Collection

Show All Figures
getmorefigures.php?uid=PMC2196039&req=5

Figure 1: Biochemical analysis of sCD80 and CTLA-4 Ig. (A) sCD80 and CTLA-4 Ig (2.5 μg each) were analyzed by SDS-PAGE on 10% acrylamide under nonreducing and reducing (+βME) conditions. The migration positions of the indicated (in kD) molecular mass markers are shown. (B) Measuring the binding activity of sCD80. Protein A–sepharose beads coated with CTLA-4 Ig or CD22 Ig were incubated with soluble sCD80, pelleted, and the supernatant analyzed for the presence of sCD80 by reducing SDS-PAGE on 12% acrylamide, together with sCD80 not exposed to beads (Control). (C) Analysis of sCD80 by size-exclusion chromatography. sCD80 (2.1 mg in 0.5 ml) was run on a SUPERDEX S200 HR10/30 column (Pharmacia) at 0.5 ml/min. The calibration markers shown (Sigma) were alcohol dehydrogenase (Mr 150,000), BSA (Mr 66,000), and carbonic anhydrase (Mr 29,000). sCD48–CD4 and sCD2 are described in the text.
Mentions: The soluble CD80 construct was designed to encode the extracellular portion of CD80 up to lysine-209 followed by a carboxy-terminal oligo-histidine tag for purification (sCD80his). It was made by PCR using cDNA from MT-2 cells (HTLV-1-transformed human T cells) as template. The 5′ primer TAGTAGAAGCTTTCCCCATCCGCTCAAGCAGGCCACCATGGGCCACACACGGAGG was complementary to the CD80 leader sequence but added an HindIII site and inserted, immediately upstream of the initiation codon, the 25 bases that precede the rat CD4 initiation codon (41). The 3′ primer TAGTAGTCTAGACTAATGATGATGATGATGATGCTTGGCTGTATTCCAGTTGAAGGT added six histidine residues and a stop codon after lysine 209, mutated threonine 208 to alanine to remove a potential NH2-linked glycosylation site, and added a XbaI site. The 10 carboxy-terminal amino acids of sCD80his were thus NTAKHHHHHH. The resulting PCR fragment was subcloned into the glutamine synthetase expression vector pEE14 (39) using its XbaI and HindIII restriction sites, and the sequence was confirmed by dideoxy sequencing. CHO-K1 cells were transfected as described (38, 39) with the sCD80hisencoding plasmid by calcium phosphate transfection. Clones expressing high levels of sCD80his (∼40 mg/L) were identified by growth in the presence of [35S]methionine/[35S]cysteine (TRANS35SLABEL; ICN Pharmaceuticals, Costa Mesa, CA), purification of labeled protein from the culture supernatant using Ni-NTA spin columns (Qiagen GmbH, Hilden, Federal Republic of Germany), and then SDS-PAGE of the protein followed by autoradiography. The best clone was grown up to confluence in bulk culture before switching to serum-free medium supplemented with 2 mM Na butyrate. sCD80his was purified by affinity chromatography using Ni-NTA resin (Qiagen GmbH) followed by size-exclusion chromatography on a SUPERDEX S200 HR10/30 column. The extinction coefficient (at 280 nm) of sCD80his was determined by amino acid analysis to be 1.41 ml.mg−1. The carboxy-terminal his tag was cleaved off by incubating 2.5 mg of sCD80his in 1.5 ml Tris–saline buffer (140 mM NaCl, 10 mM Tris [pH 7.5]) with 1.2 U of carboxypeptidase A conjugated to agarose beads (Sigma Chemical, Poole, UK) for 16 h at 30°C with agitation. Amino acid analysis confirmed that ⩾90% of the carboxy-terminal histidine residues (5.4 molecules per sCD80his molecule), but no other amino acids, were released during this incubation (data not shown). The carboxypeptidase A was removed by centrifugation and the digested sCD80his (sCD80) was repurified on a SUPERDEX S200 HR10/30 column (Fig. 1 C).

Bottom Line: Preliminary reports have suggested that CD80 binds CTLA-4 and CD28 with affinities (Kd values approximately 12 and approximately 200 nM, respectively) that are high when compared with other molecular interactions that contribute to T cell-APC recognition.In the present study, we use surface plasmon resonance to measure the affinity and kinetics of CD80 binding to CD28 and CTLA-4.At 37 degrees C, soluble recombinant CD80 bound to CTLA-4 and CD28 with Kd values of 0.42 and 4 microM, respectively.

View Article: PubMed Central - PubMed

Affiliation: Medical Research Council Cellular Immunology Unit, Sir William Dunn School of Pathology, University of Oxford, United Kingdom.

ABSTRACT
The structurally related T cell surface molecules CD28 and CTLA-4 interact with cell surface ligands CD80 (B7-1) and CD86 (B7-2) on antigen-presenting cells (APC) and modulate T cell antigen recognition. Preliminary reports have suggested that CD80 binds CTLA-4 and CD28 with affinities (Kd values approximately 12 and approximately 200 nM, respectively) that are high when compared with other molecular interactions that contribute to T cell-APC recognition. In the present study, we use surface plasmon resonance to measure the affinity and kinetics of CD80 binding to CD28 and CTLA-4. At 37 degrees C, soluble recombinant CD80 bound to CTLA-4 and CD28 with Kd values of 0.42 and 4 microM, respectively. Kinetic analysis indicated that these low affinities were the result of very fast dissociation rate constants (k(off)); sCD80 dissociated from CD28 and CTLA-4 with k(off) values of > or = 1.6 and > or = 0.43 s-1, respectively. Such rapid binding kinetics have also been reported for the T cell adhesion molecule CD2 and may be necessary to accommodate-dynamic T cell-APC contacts and to facilitate scanning of APC for antigen.

Show MeSH
Related in: MedlinePlus