Limits...
The cytokinesis gene KEULE encodes a Sec1 protein that binds the syntaxin KNOLLE.

Assaad FF, Huet Y, Mayer U, Jürgens G - J. Cell Biol. (2001)

Bottom Line: KEULE is characteristic of a Sec1 protein in that it appears to exist in two forms: soluble or peripherally associated with membranes.More importantly, KEULE binds the cytokinesis-specific syntaxin KNOLLE.Sec1 proteins are key regulators of vesicle trafficking, capable of integrating a large number of intra- and/or intercellular signals.

View Article: PubMed Central - PubMed

Affiliation: Genetics and Microbiology Institute, Ludwig Maximilians University, D-80638 Munich, Germany. fassaad@andrew2.stanford.edu

ABSTRACT
KEULE is required for cytokinesis in Arabidopsis thaliana. We have positionally cloned the KEULE gene and shown that it encodes a Sec1 protein. KEULE is expressed throughout the plant, yet appears enriched in dividing tissues. Cytokinesis-defective mutant sectors were observed in all somatic tissues upon transformation of wild-type plants with a KEULE-green fluorescent protein gene fusion, suggesting that KEULE is required not only during embryogenesis, but at all stages of the plant's life cycle. KEULE is characteristic of a Sec1 protein in that it appears to exist in two forms: soluble or peripherally associated with membranes. More importantly, KEULE binds the cytokinesis-specific syntaxin KNOLLE. Sec1 proteins are key regulators of vesicle trafficking, capable of integrating a large number of intra- and/or intercellular signals. As a cytokinesis-related Sec1 protein, KEULE appears to represent a novel link between cell cycle progression and the membrane fusion apparatus.

Show MeSH

Related in: MedlinePlus

Cloning and molecular characterization of KEULE. (A) Selected portion of the chromosome walk spanning the KEULE region. The BACs (red bars) span the gap in the YAC contig (black bars), which was otherwise only covered by the large (600–800 kb) CIC YACS CIC12A9, CIC12H10, and CIC9G11. The vertical, purple lines represent RFLP markers used for mapping and correspond to polymorphic YAC or BAC ends (filled circles represent left ends of YACs). The numbers above the bars represent the number of recombinants between the marker and keule. The −1 to +1 recombination interval corresponds to 130 kb. Y, YUP; EW, Eric Ward YACs. All BACs are from the Texas A&M University library. Not to scale. (B) Structure of the KEULE locus. The KEULE gene spans 5 kb and includes 21 exons (filled, blue boxes) and 20 introns. The upstream gene (b3 cDNA, below) is represented as an open rectangle. The intergenic region is very small (only 352 bp). Mutations in four alleles are indicated. The two breakpoints in the fast-neutron allele lie in the intergenic region, and in the middle of the KEULE gene. The EMS-induced T282 and G67 mutations lie at intron/exon junctions. MM125 is a small x-ray–induced 156-bp deletion which spans 72 bp of coding and 72 bp of intron sequences. Arrows with red arrowheads represent primers used for amplifying the 5′ and 3′ ends of the coding region. (C) A construct sufficient for mutant rescue consists of genomic sequences fused to cDNA sequences as shown. (D) Fast-neutron–induced sequence polymorphisms at the KEULE locus. Southern blots of wild-type Lansdberg DNA (wt) or of DNA heterozygous for fast-neutron (FN)-induced keule mutations were probed with the BAC T5D15 (left) with the adjacent cDNA (b3, middle) or with a PCR product corresponding to the 3′ end of the KEULE gene (right). Dra1 polymorphisms (green-headed arrows) are shown. The 3′ end of the KEULE gene detects a Dra1 polymorphism distinct from the one detected by b3. (E) PCR analysis of genomic DNA of seedlings homozygous for the MM125 x-ray–induced allele of KEULE detects a deletion at the 3′ end of the coding sequences (3′ PCR primers used). (F) RT-PCR analysis of heterozygous mutant seedlings from the EMS-induced alleles T282 and G67 reveals a small increase in exon length (98 and 85 bp expected, respectively) at the 5′ end of the coding sequences.
© Copyright Policy
Related In: Results  -  Collection


getmorefigures.php?uid=PMC2195996&req=5

Figure 2: Cloning and molecular characterization of KEULE. (A) Selected portion of the chromosome walk spanning the KEULE region. The BACs (red bars) span the gap in the YAC contig (black bars), which was otherwise only covered by the large (600–800 kb) CIC YACS CIC12A9, CIC12H10, and CIC9G11. The vertical, purple lines represent RFLP markers used for mapping and correspond to polymorphic YAC or BAC ends (filled circles represent left ends of YACs). The numbers above the bars represent the number of recombinants between the marker and keule. The −1 to +1 recombination interval corresponds to 130 kb. Y, YUP; EW, Eric Ward YACs. All BACs are from the Texas A&M University library. Not to scale. (B) Structure of the KEULE locus. The KEULE gene spans 5 kb and includes 21 exons (filled, blue boxes) and 20 introns. The upstream gene (b3 cDNA, below) is represented as an open rectangle. The intergenic region is very small (only 352 bp). Mutations in four alleles are indicated. The two breakpoints in the fast-neutron allele lie in the intergenic region, and in the middle of the KEULE gene. The EMS-induced T282 and G67 mutations lie at intron/exon junctions. MM125 is a small x-ray–induced 156-bp deletion which spans 72 bp of coding and 72 bp of intron sequences. Arrows with red arrowheads represent primers used for amplifying the 5′ and 3′ ends of the coding region. (C) A construct sufficient for mutant rescue consists of genomic sequences fused to cDNA sequences as shown. (D) Fast-neutron–induced sequence polymorphisms at the KEULE locus. Southern blots of wild-type Lansdberg DNA (wt) or of DNA heterozygous for fast-neutron (FN)-induced keule mutations were probed with the BAC T5D15 (left) with the adjacent cDNA (b3, middle) or with a PCR product corresponding to the 3′ end of the KEULE gene (right). Dra1 polymorphisms (green-headed arrows) are shown. The 3′ end of the KEULE gene detects a Dra1 polymorphism distinct from the one detected by b3. (E) PCR analysis of genomic DNA of seedlings homozygous for the MM125 x-ray–induced allele of KEULE detects a deletion at the 3′ end of the coding sequences (3′ PCR primers used). (F) RT-PCR analysis of heterozygous mutant seedlings from the EMS-induced alleles T282 and G67 reveals a small increase in exon length (98 and 85 bp expected, respectively) at the 5′ end of the coding sequences.

Mentions: A rescue construct (see Fig. 2 C) was designed by replacing the P35S promoter and GFP sequences in the P35S:GFP-KEULE NH2-terminal fusion construct in pEGAD (above) with a genomic stretch spanning the KEULE 5′ upstream sequences, 5′ UTR, the first eight exons, as well as the first seven introns. (Insert amplified from Columbia genomic DNA with primer pair: CAGGCCTGCTTAAACTCCCATTCTCAACCC and CGTACTGCTGGGAATTCC; 60°C annealing; PCR product and vector digested with EcoRI and StuI.) For mutant rescue, we used the x-ray allele MM125, which harbors a 156-bp deletion (see Fig. 2 E). Heterozygous plants were transformed and their progeny were analyzed by PCR for segregants homozygous for the MM125 locus rescued by the construct. Mutant rescue was observed with the rescue construct, but not with the GFP-KEULE fusion construct described above.


The cytokinesis gene KEULE encodes a Sec1 protein that binds the syntaxin KNOLLE.

Assaad FF, Huet Y, Mayer U, Jürgens G - J. Cell Biol. (2001)

Cloning and molecular characterization of KEULE. (A) Selected portion of the chromosome walk spanning the KEULE region. The BACs (red bars) span the gap in the YAC contig (black bars), which was otherwise only covered by the large (600–800 kb) CIC YACS CIC12A9, CIC12H10, and CIC9G11. The vertical, purple lines represent RFLP markers used for mapping and correspond to polymorphic YAC or BAC ends (filled circles represent left ends of YACs). The numbers above the bars represent the number of recombinants between the marker and keule. The −1 to +1 recombination interval corresponds to 130 kb. Y, YUP; EW, Eric Ward YACs. All BACs are from the Texas A&M University library. Not to scale. (B) Structure of the KEULE locus. The KEULE gene spans 5 kb and includes 21 exons (filled, blue boxes) and 20 introns. The upstream gene (b3 cDNA, below) is represented as an open rectangle. The intergenic region is very small (only 352 bp). Mutations in four alleles are indicated. The two breakpoints in the fast-neutron allele lie in the intergenic region, and in the middle of the KEULE gene. The EMS-induced T282 and G67 mutations lie at intron/exon junctions. MM125 is a small x-ray–induced 156-bp deletion which spans 72 bp of coding and 72 bp of intron sequences. Arrows with red arrowheads represent primers used for amplifying the 5′ and 3′ ends of the coding region. (C) A construct sufficient for mutant rescue consists of genomic sequences fused to cDNA sequences as shown. (D) Fast-neutron–induced sequence polymorphisms at the KEULE locus. Southern blots of wild-type Lansdberg DNA (wt) or of DNA heterozygous for fast-neutron (FN)-induced keule mutations were probed with the BAC T5D15 (left) with the adjacent cDNA (b3, middle) or with a PCR product corresponding to the 3′ end of the KEULE gene (right). Dra1 polymorphisms (green-headed arrows) are shown. The 3′ end of the KEULE gene detects a Dra1 polymorphism distinct from the one detected by b3. (E) PCR analysis of genomic DNA of seedlings homozygous for the MM125 x-ray–induced allele of KEULE detects a deletion at the 3′ end of the coding sequences (3′ PCR primers used). (F) RT-PCR analysis of heterozygous mutant seedlings from the EMS-induced alleles T282 and G67 reveals a small increase in exon length (98 and 85 bp expected, respectively) at the 5′ end of the coding sequences.
© Copyright Policy
Related In: Results  -  Collection

Show All Figures
getmorefigures.php?uid=PMC2195996&req=5

Figure 2: Cloning and molecular characterization of KEULE. (A) Selected portion of the chromosome walk spanning the KEULE region. The BACs (red bars) span the gap in the YAC contig (black bars), which was otherwise only covered by the large (600–800 kb) CIC YACS CIC12A9, CIC12H10, and CIC9G11. The vertical, purple lines represent RFLP markers used for mapping and correspond to polymorphic YAC or BAC ends (filled circles represent left ends of YACs). The numbers above the bars represent the number of recombinants between the marker and keule. The −1 to +1 recombination interval corresponds to 130 kb. Y, YUP; EW, Eric Ward YACs. All BACs are from the Texas A&M University library. Not to scale. (B) Structure of the KEULE locus. The KEULE gene spans 5 kb and includes 21 exons (filled, blue boxes) and 20 introns. The upstream gene (b3 cDNA, below) is represented as an open rectangle. The intergenic region is very small (only 352 bp). Mutations in four alleles are indicated. The two breakpoints in the fast-neutron allele lie in the intergenic region, and in the middle of the KEULE gene. The EMS-induced T282 and G67 mutations lie at intron/exon junctions. MM125 is a small x-ray–induced 156-bp deletion which spans 72 bp of coding and 72 bp of intron sequences. Arrows with red arrowheads represent primers used for amplifying the 5′ and 3′ ends of the coding region. (C) A construct sufficient for mutant rescue consists of genomic sequences fused to cDNA sequences as shown. (D) Fast-neutron–induced sequence polymorphisms at the KEULE locus. Southern blots of wild-type Lansdberg DNA (wt) or of DNA heterozygous for fast-neutron (FN)-induced keule mutations were probed with the BAC T5D15 (left) with the adjacent cDNA (b3, middle) or with a PCR product corresponding to the 3′ end of the KEULE gene (right). Dra1 polymorphisms (green-headed arrows) are shown. The 3′ end of the KEULE gene detects a Dra1 polymorphism distinct from the one detected by b3. (E) PCR analysis of genomic DNA of seedlings homozygous for the MM125 x-ray–induced allele of KEULE detects a deletion at the 3′ end of the coding sequences (3′ PCR primers used). (F) RT-PCR analysis of heterozygous mutant seedlings from the EMS-induced alleles T282 and G67 reveals a small increase in exon length (98 and 85 bp expected, respectively) at the 5′ end of the coding sequences.
Mentions: A rescue construct (see Fig. 2 C) was designed by replacing the P35S promoter and GFP sequences in the P35S:GFP-KEULE NH2-terminal fusion construct in pEGAD (above) with a genomic stretch spanning the KEULE 5′ upstream sequences, 5′ UTR, the first eight exons, as well as the first seven introns. (Insert amplified from Columbia genomic DNA with primer pair: CAGGCCTGCTTAAACTCCCATTCTCAACCC and CGTACTGCTGGGAATTCC; 60°C annealing; PCR product and vector digested with EcoRI and StuI.) For mutant rescue, we used the x-ray allele MM125, which harbors a 156-bp deletion (see Fig. 2 E). Heterozygous plants were transformed and their progeny were analyzed by PCR for segregants homozygous for the MM125 locus rescued by the construct. Mutant rescue was observed with the rescue construct, but not with the GFP-KEULE fusion construct described above.

Bottom Line: KEULE is characteristic of a Sec1 protein in that it appears to exist in two forms: soluble or peripherally associated with membranes.More importantly, KEULE binds the cytokinesis-specific syntaxin KNOLLE.Sec1 proteins are key regulators of vesicle trafficking, capable of integrating a large number of intra- and/or intercellular signals.

View Article: PubMed Central - PubMed

Affiliation: Genetics and Microbiology Institute, Ludwig Maximilians University, D-80638 Munich, Germany. fassaad@andrew2.stanford.edu

ABSTRACT
KEULE is required for cytokinesis in Arabidopsis thaliana. We have positionally cloned the KEULE gene and shown that it encodes a Sec1 protein. KEULE is expressed throughout the plant, yet appears enriched in dividing tissues. Cytokinesis-defective mutant sectors were observed in all somatic tissues upon transformation of wild-type plants with a KEULE-green fluorescent protein gene fusion, suggesting that KEULE is required not only during embryogenesis, but at all stages of the plant's life cycle. KEULE is characteristic of a Sec1 protein in that it appears to exist in two forms: soluble or peripherally associated with membranes. More importantly, KEULE binds the cytokinesis-specific syntaxin KNOLLE. Sec1 proteins are key regulators of vesicle trafficking, capable of integrating a large number of intra- and/or intercellular signals. As a cytokinesis-related Sec1 protein, KEULE appears to represent a novel link between cell cycle progression and the membrane fusion apparatus.

Show MeSH
Related in: MedlinePlus