Limits...
The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein.

Abella M, Rodríguez S, Paytubi S, Campoy S, White MF, Barbé J - Nucleic Acids Res. (2007)

Bottom Line: Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene.Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding.Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.

View Article: PubMed Central - PubMed

Affiliation: Departament de Genètica i Microbiologia, Universitat Autònoma de Barcelona 08193 Bellaterra, Spain.

ABSTRACT
Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.

Show MeSH

Related in: MedlinePlus

(A) Actinomycin D-mediated induction of S. solfataricus sta1 measured by quantitative RT-PCR. The induction factor in the presence (+) or in the absence (−) of actinomycin D is shown. The induction factor is the ratio between the relative mRNA concentration for sta1 gene measured by quantitative RT-PCR in the presence or absence of actinomycin D cultures and that obtained in the S. solfataricus untreated culture. The relative mRNA concentration is normalized with the 23S ribosomal RNA. The mean value from three independent experiments (each in triplicate) is shown. (B) EMSA experiments of the DIG-labelled S. solfataricus sta1 promoter in the presence of increasing amounts of Sta1 protein.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC2175319&req=5

Figure 9: (A) Actinomycin D-mediated induction of S. solfataricus sta1 measured by quantitative RT-PCR. The induction factor in the presence (+) or in the absence (−) of actinomycin D is shown. The induction factor is the ratio between the relative mRNA concentration for sta1 gene measured by quantitative RT-PCR in the presence or absence of actinomycin D cultures and that obtained in the S. solfataricus untreated culture. The relative mRNA concentration is normalized with the 23S ribosomal RNA. The mean value from three independent experiments (each in triplicate) is shown. (B) EMSA experiments of the DIG-labelled S. solfataricus sta1 promoter in the presence of increasing amounts of Sta1 protein.

Mentions: The gel-shift data presented here, together with the known property of Sta1 to act as a transcriptional activator for viral promoters, suggested that the Sta1 protein might function as a transcriptional regulator of the sso0777 gene. To determine this, in vitro transcription assays, using highly purified S. solfataricus RNAP and purified recombinant S. solfataricus TBP and TFB, were performed on the sso0777 and T6 promoters, with increasing concentrations of Sta1 (Figure 8). The T6 promoter was used as a negative control as it has been described that transcription from this promoter is not affected by the Sta1 protein (20). As seen in Figure 8, the yield of transcripts from the sso0777 promoter was stimulated 3- to 4-fold by the addition of increasing concentrations of Sta1 whilst the T6 promoter, as expected, was insensitive to the addition of Sta1. Moreover, it is worth noting that despite expression of Sta1 increases in the presence of actinomycin D showing an induction factor of 5.75 (Figure 9A), it is unlikely to be autoregulated since Sta1 is unable to bind to its own promoter (Figure 9B).Figure 9.


The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein.

Abella M, Rodríguez S, Paytubi S, Campoy S, White MF, Barbé J - Nucleic Acids Res. (2007)

(A) Actinomycin D-mediated induction of S. solfataricus sta1 measured by quantitative RT-PCR. The induction factor in the presence (+) or in the absence (−) of actinomycin D is shown. The induction factor is the ratio between the relative mRNA concentration for sta1 gene measured by quantitative RT-PCR in the presence or absence of actinomycin D cultures and that obtained in the S. solfataricus untreated culture. The relative mRNA concentration is normalized with the 23S ribosomal RNA. The mean value from three independent experiments (each in triplicate) is shown. (B) EMSA experiments of the DIG-labelled S. solfataricus sta1 promoter in the presence of increasing amounts of Sta1 protein.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC2175319&req=5

Figure 9: (A) Actinomycin D-mediated induction of S. solfataricus sta1 measured by quantitative RT-PCR. The induction factor in the presence (+) or in the absence (−) of actinomycin D is shown. The induction factor is the ratio between the relative mRNA concentration for sta1 gene measured by quantitative RT-PCR in the presence or absence of actinomycin D cultures and that obtained in the S. solfataricus untreated culture. The relative mRNA concentration is normalized with the 23S ribosomal RNA. The mean value from three independent experiments (each in triplicate) is shown. (B) EMSA experiments of the DIG-labelled S. solfataricus sta1 promoter in the presence of increasing amounts of Sta1 protein.
Mentions: The gel-shift data presented here, together with the known property of Sta1 to act as a transcriptional activator for viral promoters, suggested that the Sta1 protein might function as a transcriptional regulator of the sso0777 gene. To determine this, in vitro transcription assays, using highly purified S. solfataricus RNAP and purified recombinant S. solfataricus TBP and TFB, were performed on the sso0777 and T6 promoters, with increasing concentrations of Sta1 (Figure 8). The T6 promoter was used as a negative control as it has been described that transcription from this promoter is not affected by the Sta1 protein (20). As seen in Figure 8, the yield of transcripts from the sso0777 promoter was stimulated 3- to 4-fold by the addition of increasing concentrations of Sta1 whilst the T6 promoter, as expected, was insensitive to the addition of Sta1. Moreover, it is worth noting that despite expression of Sta1 increases in the presence of actinomycin D showing an induction factor of 5.75 (Figure 9A), it is unlikely to be autoregulated since Sta1 is unable to bind to its own promoter (Figure 9B).Figure 9.

Bottom Line: Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene.Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding.Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.

View Article: PubMed Central - PubMed

Affiliation: Departament de Genètica i Microbiologia, Universitat Autònoma de Barcelona 08193 Bellaterra, Spain.

ABSTRACT
Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.

Show MeSH
Related in: MedlinePlus