Limits...
The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein.

Abella M, Rodríguez S, Paytubi S, Campoy S, White MF, Barbé J - Nucleic Acids Res. (2007)

Bottom Line: Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene.Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding.Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.

View Article: PubMed Central - PubMed

Affiliation: Departament de Genètica i Microbiologia, Universitat Autònoma de Barcelona 08193 Bellaterra, Spain.

ABSTRACT
Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.

Show MeSH
Effect of Sta1 on T6 and sso0777 promoters. The in vitro transcription assay was performed in the presence of increasing concentrations of Sta1 (0, 50, 250, 500, 1000, 1500 and 2500 ng). The products of the in vitro transcription of promoters indicated were detected by primer extension analysis and electrophored on a 12% denaturing polyacrylamide gel. RNAP : TFB-1 : TBP concentrations used were 40 : 300 : 300 (nM). Percentage of transcription referred to the first lane (no Sta1) is shown under each panel.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC2175319&req=5

Figure 8: Effect of Sta1 on T6 and sso0777 promoters. The in vitro transcription assay was performed in the presence of increasing concentrations of Sta1 (0, 50, 250, 500, 1000, 1500 and 2500 ng). The products of the in vitro transcription of promoters indicated were detected by primer extension analysis and electrophored on a 12% denaturing polyacrylamide gel. RNAP : TFB-1 : TBP concentrations used were 40 : 300 : 300 (nM). Percentage of transcription referred to the first lane (no Sta1) is shown under each panel.

Mentions: Plasmid carrying T6 promoter was generated as described previously (29) and plasmid carrying the sso0777 promoter was generated from genomic S. solfataricus P2 DNA using standard conditions and oligonucleotides psso0777for and psso0777rev (Table S1). The PCR products were cloned directly into pCR2.1-TOPO (Invitrogen). In vitro transcription reactions were performed in a 50 μl mixture containing 50 ng of the corresponding linear plasmid containing the T6 or the sso0777 promoters (XhoI digestion of pT6 and psso0777), 200 μM of each rNTP, 40 nM of RNAP, 300 nM of TFB-1, 300 nM of TBP and Sta1 in amounts indicated in Figure 8. Sta1 was incubated with the DNA for 15 min at 65°C prior to the transcription assay. The reactions were carried out for 10 min at 70°C in transcription buffer [20 mM Tris–HCl (pH 8.0), 220 mM KCl, 10 mM MgCl2 and 2 mM DTT] and then rNTPs were added to the reaction, which was allowed to continue for 20 min. The reactions were stopped by chilling on ice. The in vitro synthesized RNA (1.5 μl for T6 and 12.6 μl for sso0777) was then used as a template for primer extension reactions. Transcription products were detected by primer extension using 300 fmol of [γ-32P]ATP-labelled primers, T6R primer or sso0777RV primer (Table S1) for T6 and sso0777 transcripts, respectively.


The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein.

Abella M, Rodríguez S, Paytubi S, Campoy S, White MF, Barbé J - Nucleic Acids Res. (2007)

Effect of Sta1 on T6 and sso0777 promoters. The in vitro transcription assay was performed in the presence of increasing concentrations of Sta1 (0, 50, 250, 500, 1000, 1500 and 2500 ng). The products of the in vitro transcription of promoters indicated were detected by primer extension analysis and electrophored on a 12% denaturing polyacrylamide gel. RNAP : TFB-1 : TBP concentrations used were 40 : 300 : 300 (nM). Percentage of transcription referred to the first lane (no Sta1) is shown under each panel.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC2175319&req=5

Figure 8: Effect of Sta1 on T6 and sso0777 promoters. The in vitro transcription assay was performed in the presence of increasing concentrations of Sta1 (0, 50, 250, 500, 1000, 1500 and 2500 ng). The products of the in vitro transcription of promoters indicated were detected by primer extension analysis and electrophored on a 12% denaturing polyacrylamide gel. RNAP : TFB-1 : TBP concentrations used were 40 : 300 : 300 (nM). Percentage of transcription referred to the first lane (no Sta1) is shown under each panel.
Mentions: Plasmid carrying T6 promoter was generated as described previously (29) and plasmid carrying the sso0777 promoter was generated from genomic S. solfataricus P2 DNA using standard conditions and oligonucleotides psso0777for and psso0777rev (Table S1). The PCR products were cloned directly into pCR2.1-TOPO (Invitrogen). In vitro transcription reactions were performed in a 50 μl mixture containing 50 ng of the corresponding linear plasmid containing the T6 or the sso0777 promoters (XhoI digestion of pT6 and psso0777), 200 μM of each rNTP, 40 nM of RNAP, 300 nM of TFB-1, 300 nM of TBP and Sta1 in amounts indicated in Figure 8. Sta1 was incubated with the DNA for 15 min at 65°C prior to the transcription assay. The reactions were carried out for 10 min at 70°C in transcription buffer [20 mM Tris–HCl (pH 8.0), 220 mM KCl, 10 mM MgCl2 and 2 mM DTT] and then rNTPs were added to the reaction, which was allowed to continue for 20 min. The reactions were stopped by chilling on ice. The in vitro synthesized RNA (1.5 μl for T6 and 12.6 μl for sso0777) was then used as a template for primer extension reactions. Transcription products were detected by primer extension using 300 fmol of [γ-32P]ATP-labelled primers, T6R primer or sso0777RV primer (Table S1) for T6 and sso0777 transcripts, respectively.

Bottom Line: Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene.Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding.Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.

View Article: PubMed Central - PubMed

Affiliation: Departament de Genètica i Microbiologia, Universitat Autònoma de Barcelona 08193 Bellaterra, Spain.

ABSTRACT
Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.

Show MeSH