Limits...
The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein.

Abella M, Rodríguez S, Paytubi S, Campoy S, White MF, Barbé J - Nucleic Acids Res. (2007)

Bottom Line: Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene.Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding.Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.

View Article: PubMed Central - PubMed

Affiliation: Departament de Genètica i Microbiologia, Universitat Autònoma de Barcelona 08193 Bellaterra, Spain.

ABSTRACT
Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.

Show MeSH

Related in: MedlinePlus

DNase I footprinting assays with coding and non-coding Cy5-labelled strands of the DNA fragment containing the S. solfataricus sso0777 promoter in the absence or presence of Sta1 protein. The position of the protected region, relative to the TTG translational start codon of sso0777, is shown.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC2175319&req=5

Figure 6: DNase I footprinting assays with coding and non-coding Cy5-labelled strands of the DNA fragment containing the S. solfataricus sso0777 promoter in the absence or presence of Sta1 protein. The position of the protected region, relative to the TTG translational start codon of sso0777, is shown.

Mentions: To determine the precise DNA-binding region of the Sta1 protein, a footprinting assay using a fragment from −63 to +61, with respect to the TTG start codon, was carried out. Data obtained indicated that the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence was protected by the Sta1 protein (Figure 6). The above-mentioned sequence contains the previously described (20) consensus-binding site for Sta1 to the SIVR1 viral promoters (ATNTN10AT). However, the precise role of each nucleotide of the protected sequence had not been previously determined. For this reason, and to further characterize the Sta1-binding sequence and to know the most important nucleotides that are recognized by this protein, EMSA experiments using probes with specific point mutations in the protected region of the sso0777 promoter were performed. As it is shown in Figure 7, several motifs seem to be essential for Sta1 binding. First, two spaced TTATT motifs, one located between –42 and –38 and the other placed between –21 and –17 nucleotides relative to the TTG start codon. Additionally, a CANGNA sequence between the two TTATT motifs was also necessary for the binding of Sta1 (Figure 7).Figure 6.


The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein.

Abella M, Rodríguez S, Paytubi S, Campoy S, White MF, Barbé J - Nucleic Acids Res. (2007)

DNase I footprinting assays with coding and non-coding Cy5-labelled strands of the DNA fragment containing the S. solfataricus sso0777 promoter in the absence or presence of Sta1 protein. The position of the protected region, relative to the TTG translational start codon of sso0777, is shown.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC2175319&req=5

Figure 6: DNase I footprinting assays with coding and non-coding Cy5-labelled strands of the DNA fragment containing the S. solfataricus sso0777 promoter in the absence or presence of Sta1 protein. The position of the protected region, relative to the TTG translational start codon of sso0777, is shown.
Mentions: To determine the precise DNA-binding region of the Sta1 protein, a footprinting assay using a fragment from −63 to +61, with respect to the TTG start codon, was carried out. Data obtained indicated that the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence was protected by the Sta1 protein (Figure 6). The above-mentioned sequence contains the previously described (20) consensus-binding site for Sta1 to the SIVR1 viral promoters (ATNTN10AT). However, the precise role of each nucleotide of the protected sequence had not been previously determined. For this reason, and to further characterize the Sta1-binding sequence and to know the most important nucleotides that are recognized by this protein, EMSA experiments using probes with specific point mutations in the protected region of the sso0777 promoter were performed. As it is shown in Figure 7, several motifs seem to be essential for Sta1 binding. First, two spaced TTATT motifs, one located between –42 and –38 and the other placed between –21 and –17 nucleotides relative to the TTG start codon. Additionally, a CANGNA sequence between the two TTATT motifs was also necessary for the binding of Sta1 (Figure 7).Figure 6.

Bottom Line: Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene.Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding.Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.

View Article: PubMed Central - PubMed

Affiliation: Departament de Genètica i Microbiologia, Universitat Autònoma de Barcelona 08193 Bellaterra, Spain.

ABSTRACT
Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.

Show MeSH
Related in: MedlinePlus