Limits...
The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein.

Abella M, Rodríguez S, Paytubi S, Campoy S, White MF, Barbé J - Nucleic Acids Res. (2007)

Bottom Line: Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene.Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding.Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.

View Article: PubMed Central - PubMed

Affiliation: Departament de Genètica i Microbiologia, Universitat Autònoma de Barcelona 08193 Bellaterra, Spain.

ABSTRACT
Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.

Show MeSH

Related in: MedlinePlus

(A) Overexpression and purification of the S. solfataricus Sta1 protein. Lanes 1 and 2 contain crude extracts from E. coli BL21(DE3) pET15b/sta1 in the absence or in the presence of 10 mM IPTG, respectively. Lane 3 contains the trombin digested Sta1 purified protein. The molecular weight of protein markers are indicated on the left side. (B) EMSA experiments with 100 ng of pure Sta1 protein plus the FrgB sso0777 promoter fragment as a probe. The specificity of the binding was tested using 300-fold molar excess of either unlabelled sso0777 or T6 promoters, as a specific or non-specific competitor fragment, respectively. As a control, crude S. solfataricus cell extracts were also used revealing the same mobility shift as the purified Sta1 protein.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC2175319&req=5

Figure 5: (A) Overexpression and purification of the S. solfataricus Sta1 protein. Lanes 1 and 2 contain crude extracts from E. coli BL21(DE3) pET15b/sta1 in the absence or in the presence of 10 mM IPTG, respectively. Lane 3 contains the trombin digested Sta1 purified protein. The molecular weight of protein markers are indicated on the left side. (B) EMSA experiments with 100 ng of pure Sta1 protein plus the FrgB sso0777 promoter fragment as a probe. The specificity of the binding was tested using 300-fold molar excess of either unlabelled sso0777 or T6 promoters, as a specific or non-specific competitor fragment, respectively. As a control, crude S. solfataricus cell extracts were also used revealing the same mobility shift as the purified Sta1 protein.

Mentions: The sta1 (sso0048) and sso0110 genes were amplified by PCR using either SSO0048Nde and SSO0048Bam primers or SSO0110Nde and SSO0110Bam oligonucleotides, respectively (Table S1), containing the suitable endonuclease restriction sites and were cloned into a pGEM-T vector (Promega) followed by the subcloning into a pET15b expression vector. For overexpression, either the pET15b-sta1 or pET15b-sso0110 constructs were transformed into the E. coli BL21(DE3) CodonPlus RIL strain (Stratagene, CA, USA) for further expression of the recombinant proteins. Transformant cells were grown in LB at 30°C and a 3 h induction was carried out adding 1 mM IPTG to the culture. His-tagged proteins were purified using the Talon™ Metal Affinity Resin Kit (Clontech) following the manufacture's instructions. To remove the His-tag, the purified proteins were cleaved with thrombin. Either Sta1 (Figure 5A) and Sso0110 (data not shown) recombinant proteins obtained were above 95% purity as determined with Coomassie Blue staining of SDS–PAGE (15%) gel.


The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein.

Abella M, Rodríguez S, Paytubi S, Campoy S, White MF, Barbé J - Nucleic Acids Res. (2007)

(A) Overexpression and purification of the S. solfataricus Sta1 protein. Lanes 1 and 2 contain crude extracts from E. coli BL21(DE3) pET15b/sta1 in the absence or in the presence of 10 mM IPTG, respectively. Lane 3 contains the trombin digested Sta1 purified protein. The molecular weight of protein markers are indicated on the left side. (B) EMSA experiments with 100 ng of pure Sta1 protein plus the FrgB sso0777 promoter fragment as a probe. The specificity of the binding was tested using 300-fold molar excess of either unlabelled sso0777 or T6 promoters, as a specific or non-specific competitor fragment, respectively. As a control, crude S. solfataricus cell extracts were also used revealing the same mobility shift as the purified Sta1 protein.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC2175319&req=5

Figure 5: (A) Overexpression and purification of the S. solfataricus Sta1 protein. Lanes 1 and 2 contain crude extracts from E. coli BL21(DE3) pET15b/sta1 in the absence or in the presence of 10 mM IPTG, respectively. Lane 3 contains the trombin digested Sta1 purified protein. The molecular weight of protein markers are indicated on the left side. (B) EMSA experiments with 100 ng of pure Sta1 protein plus the FrgB sso0777 promoter fragment as a probe. The specificity of the binding was tested using 300-fold molar excess of either unlabelled sso0777 or T6 promoters, as a specific or non-specific competitor fragment, respectively. As a control, crude S. solfataricus cell extracts were also used revealing the same mobility shift as the purified Sta1 protein.
Mentions: The sta1 (sso0048) and sso0110 genes were amplified by PCR using either SSO0048Nde and SSO0048Bam primers or SSO0110Nde and SSO0110Bam oligonucleotides, respectively (Table S1), containing the suitable endonuclease restriction sites and were cloned into a pGEM-T vector (Promega) followed by the subcloning into a pET15b expression vector. For overexpression, either the pET15b-sta1 or pET15b-sso0110 constructs were transformed into the E. coli BL21(DE3) CodonPlus RIL strain (Stratagene, CA, USA) for further expression of the recombinant proteins. Transformant cells were grown in LB at 30°C and a 3 h induction was carried out adding 1 mM IPTG to the culture. His-tagged proteins were purified using the Talon™ Metal Affinity Resin Kit (Clontech) following the manufacture's instructions. To remove the His-tag, the purified proteins were cleaved with thrombin. Either Sta1 (Figure 5A) and Sso0110 (data not shown) recombinant proteins obtained were above 95% purity as determined with Coomassie Blue staining of SDS–PAGE (15%) gel.

Bottom Line: Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene.Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding.Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.

View Article: PubMed Central - PubMed

Affiliation: Departament de Genètica i Microbiologia, Universitat Autònoma de Barcelona 08193 Bellaterra, Spain.

ABSTRACT
Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.

Show MeSH
Related in: MedlinePlus