Limits...
The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein.

Abella M, Rodríguez S, Paytubi S, Campoy S, White MF, Barbé J - Nucleic Acids Res. (2007)

Bottom Line: Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene.Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding.Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.

View Article: PubMed Central - PubMed

Affiliation: Departament de Genètica i Microbiologia, Universitat Autònoma de Barcelona 08193 Bellaterra, Spain.

ABSTRACT
Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.

Show MeSH

Related in: MedlinePlus

(A) Schematic diagram of the sso0777 promoter. The position of the primers used to obtain several promoter fragments (FrgA, FrgB and FrgC) is indicated. (B) EMSA experiments using FrgA, FrgB and FrgC fragments from sso0777 promoter shown above in the presence (+) or absence (−) of crude S. solfataricus cell extracts.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC2175319&req=5

Figure 3: (A) Schematic diagram of the sso0777 promoter. The position of the primers used to obtain several promoter fragments (FrgA, FrgB and FrgC) is indicated. (B) EMSA experiments using FrgA, FrgB and FrgC fragments from sso0777 promoter shown above in the presence (+) or absence (−) of crude S. solfataricus cell extracts.

Mentions: In contrast, a change in the electrophoretic mobility of the sso0777 upstream region was detected when incubated in the presence of crude S. solfataricus cell extracts (Figure 2). The presence of the unlabelled competitor sso0777 DNA fragment in the reaction mixture did prevent the band shift (Figure 2), while the addition of 300-fold of unlabelled competitor DNA from the T6 promoter region (26) did not affect the retardation band formation, confirming the binding specificity. Regarding all of these data, we attempted to identify the protein(s) responsible for the change in the mobility pattern of the sso0777 promoter region as well as its (their) DNA-binding sequence. For that purpose, several fragments of different lengths of the promoter region were generated and designated as FrgA (−107 to +61), FrgB (−63 to +61) and FrgC (−23 to +61) (Figure 3A). A retarded band was observed when FrgA and FrgB fragments were incubated in the presence of crude S. solfataricus cell extracts, in contrast the mobility of the fragment covering positions from −23 to +61, FrgC, was unaffected under the same conditions (Figure 3B). Taken all these data together, the region spanning from −63 to −23 is the minimal region required for the band shift of sso0777 promoter.Figure 2.


The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein.

Abella M, Rodríguez S, Paytubi S, Campoy S, White MF, Barbé J - Nucleic Acids Res. (2007)

(A) Schematic diagram of the sso0777 promoter. The position of the primers used to obtain several promoter fragments (FrgA, FrgB and FrgC) is indicated. (B) EMSA experiments using FrgA, FrgB and FrgC fragments from sso0777 promoter shown above in the presence (+) or absence (−) of crude S. solfataricus cell extracts.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC2175319&req=5

Figure 3: (A) Schematic diagram of the sso0777 promoter. The position of the primers used to obtain several promoter fragments (FrgA, FrgB and FrgC) is indicated. (B) EMSA experiments using FrgA, FrgB and FrgC fragments from sso0777 promoter shown above in the presence (+) or absence (−) of crude S. solfataricus cell extracts.
Mentions: In contrast, a change in the electrophoretic mobility of the sso0777 upstream region was detected when incubated in the presence of crude S. solfataricus cell extracts (Figure 2). The presence of the unlabelled competitor sso0777 DNA fragment in the reaction mixture did prevent the band shift (Figure 2), while the addition of 300-fold of unlabelled competitor DNA from the T6 promoter region (26) did not affect the retardation band formation, confirming the binding specificity. Regarding all of these data, we attempted to identify the protein(s) responsible for the change in the mobility pattern of the sso0777 promoter region as well as its (their) DNA-binding sequence. For that purpose, several fragments of different lengths of the promoter region were generated and designated as FrgA (−107 to +61), FrgB (−63 to +61) and FrgC (−23 to +61) (Figure 3A). A retarded band was observed when FrgA and FrgB fragments were incubated in the presence of crude S. solfataricus cell extracts, in contrast the mobility of the fragment covering positions from −23 to +61, FrgC, was unaffected under the same conditions (Figure 3B). Taken all these data together, the region spanning from −63 to −23 is the minimal region required for the band shift of sso0777 promoter.Figure 2.

Bottom Line: Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene.Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding.Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.

View Article: PubMed Central - PubMed

Affiliation: Departament de Genètica i Microbiologia, Universitat Autònoma de Barcelona 08193 Bellaterra, Spain.

ABSTRACT
Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.

Show MeSH
Related in: MedlinePlus