Limits...
The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein.

Abella M, Rodríguez S, Paytubi S, Campoy S, White MF, Barbé J - Nucleic Acids Res. (2007)

Bottom Line: Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene.Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding.Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.

View Article: PubMed Central - PubMed

Affiliation: Departament de Genètica i Microbiologia, Universitat Autònoma de Barcelona 08193 Bellaterra, Spain.

ABSTRACT
Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.

Show MeSH

Related in: MedlinePlus

Actinomycin D-mediated induction of S. solfataricus radA and sso0777 genes measured by quantitative RT-PCR. For each gene, the induction factor in the presence (+) or in the absence (−) of actinomycin D is shown. The induction factor is the ratio between the relative mRNA concentration for either radA or sso0777 genes measured by quantitative RT-PCR in the presence or absence of actinomycin D cultures and that obtained in the S. solfataricus untreated culture. The relative mRNA concentration for each gene is normalized with the 23S ribosomal RNA. In each case, the mean value from three independent experiments (each in triplicate) is shown.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC2175319&req=5

Figure 1: Actinomycin D-mediated induction of S. solfataricus radA and sso0777 genes measured by quantitative RT-PCR. For each gene, the induction factor in the presence (+) or in the absence (−) of actinomycin D is shown. The induction factor is the ratio between the relative mRNA concentration for either radA or sso0777 genes measured by quantitative RT-PCR in the presence or absence of actinomycin D cultures and that obtained in the S. solfataricus untreated culture. The relative mRNA concentration for each gene is normalized with the 23S ribosomal RNA. In each case, the mean value from three independent experiments (each in triplicate) is shown.

Mentions: As a first approach to analyse the regulation of putative damage-induced genes in S. solfataricus, we assayed the induction of two genes: radA (sso0250) and a radA paralogue (sso0777). These genes are homologues of bacterial recA and eukaryal rad51/DMC1 recombinases, which respond to DNA damage in some mesophilic archaea (Methanococcus voltae, Methanococcus maripaludis, Halobacterium NRC-1) and thermophilic archaea (Methanococcus jannaschii, P. furiosus) (30,13,14). We used actinomycin D as a DNA damaging agent, since it has been previously shown that this compound is an effective DNA damage generator agent in S. solfataricus (19). As shown in Figure 1, addition of actinomycin D to S. solfataricus gives rise to a significant increase in the levels of mRNA of both radA and sso0777 genes detected by real-time RT-PCR, demonstrating that these two genes are involved in the S. solfataricus DNA damage-inducible response.Figure 1.


The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein.

Abella M, Rodríguez S, Paytubi S, Campoy S, White MF, Barbé J - Nucleic Acids Res. (2007)

Actinomycin D-mediated induction of S. solfataricus radA and sso0777 genes measured by quantitative RT-PCR. For each gene, the induction factor in the presence (+) or in the absence (−) of actinomycin D is shown. The induction factor is the ratio between the relative mRNA concentration for either radA or sso0777 genes measured by quantitative RT-PCR in the presence or absence of actinomycin D cultures and that obtained in the S. solfataricus untreated culture. The relative mRNA concentration for each gene is normalized with the 23S ribosomal RNA. In each case, the mean value from three independent experiments (each in triplicate) is shown.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC2175319&req=5

Figure 1: Actinomycin D-mediated induction of S. solfataricus radA and sso0777 genes measured by quantitative RT-PCR. For each gene, the induction factor in the presence (+) or in the absence (−) of actinomycin D is shown. The induction factor is the ratio between the relative mRNA concentration for either radA or sso0777 genes measured by quantitative RT-PCR in the presence or absence of actinomycin D cultures and that obtained in the S. solfataricus untreated culture. The relative mRNA concentration for each gene is normalized with the 23S ribosomal RNA. In each case, the mean value from three independent experiments (each in triplicate) is shown.
Mentions: As a first approach to analyse the regulation of putative damage-induced genes in S. solfataricus, we assayed the induction of two genes: radA (sso0250) and a radA paralogue (sso0777). These genes are homologues of bacterial recA and eukaryal rad51/DMC1 recombinases, which respond to DNA damage in some mesophilic archaea (Methanococcus voltae, Methanococcus maripaludis, Halobacterium NRC-1) and thermophilic archaea (Methanococcus jannaschii, P. furiosus) (30,13,14). We used actinomycin D as a DNA damaging agent, since it has been previously shown that this compound is an effective DNA damage generator agent in S. solfataricus (19). As shown in Figure 1, addition of actinomycin D to S. solfataricus gives rise to a significant increase in the levels of mRNA of both radA and sso0777 genes detected by real-time RT-PCR, demonstrating that these two genes are involved in the S. solfataricus DNA damage-inducible response.Figure 1.

Bottom Line: Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene.Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding.Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.

View Article: PubMed Central - PubMed

Affiliation: Departament de Genètica i Microbiologia, Universitat Autònoma de Barcelona 08193 Bellaterra, Spain.

ABSTRACT
Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.

Show MeSH
Related in: MedlinePlus