Limits...
An engineered L-arginine sensor of Chlamydia pneumoniae enables arginine-adjustable transcription control in mammalian cells and mice.

Hartenbach S, Daoud-El Baba M, Weber W, Fussenegger M - Nucleic Acids Res. (2007)

Bottom Line: Arginine-controlled transgene expression showed rapid induction kinetics in a variety of mammalian cell lines and was adjustable and reversible at concentrations which were compatible with host cell physiology.ART variants containing different transactivation domains, variable spacing between ARG box and minimal promoter and several tandem ARG boxes showed modified regulation performance tailored for specific expression scenarios and cell types.Mice implanted with microencapsulated cells engineered for ART-inducible expression of the human placental secreted alkaline phosphatase (SEAP) exhibited adjustable serum phosphatase levels after treatment with different arginine doses.

View Article: PubMed Central - PubMed

Affiliation: Institute for Chemical and Bioengineering, ETH Zurich, Wolfgang-Pauli-Strasse 10, HCI F115, CH-8093 Zurich, Switzerland.

ABSTRACT
For optimal compatibility with biopharmaceutical manufacturing and gene therapy, heterologous transgene control systems must be responsive to side-effect-free physiologic inducer molecules. The arginine-inducible interaction of the ArgR repressor and the ArgR-specific ARG box, which synchronize arginine import and synthesis in the intracellular human pathogen Chlamydia pneumoniae, was engineered for arginine-regulated transgene (ART) expression in mammalian cells. A synthetic arginine-responsive transactivator (ARG), consisting of ArgR fused to the Herpes simplex VP16 transactivation domain, reversibly adjusted transgene transcription of chimeric ARG box-containing mammalian minimal promoters (P(ART)) in an arginine-inducible manner. Arginine-controlled transgene expression showed rapid induction kinetics in a variety of mammalian cell lines and was adjustable and reversible at concentrations which were compatible with host cell physiology. ART variants containing different transactivation domains, variable spacing between ARG box and minimal promoter and several tandem ARG boxes showed modified regulation performance tailored for specific expression scenarios and cell types. Mice implanted with microencapsulated cells engineered for ART-inducible expression of the human placental secreted alkaline phosphatase (SEAP) exhibited adjustable serum phosphatase levels after treatment with different arginine doses. Using a physiologic inducer, such as the amino acid l-arginine, to control heterologous transgenes in a seamless manner which is devoid of noticeable metabolic interference will foster novel opportunities for precise expression dosing in future gene therapy scenarios as well as the manufacturing of difficult-to-produce protein pharmaceuticals.

Show MeSH

Related in: MedlinePlus

Diagram of the ART regulation system. (A) The bacterial repressor ArgR of Chlamydia pneumoniae, fused to the human NF-κB transactivation domain (ARG1, ArgR-p65), is expressed in a constitutive manner under the control of the simian virus 40 promoter (PSV40). The l-arginine-responsive promoter (PART1) harbors an ArgR-specific operator sequence (OARG, capital letters, ARG boxes underlined) upstream of the minimal version of the cytomegalovirus immediate early promoter (PhCMVmin) and drives expression of a reporter gene (e.g. human secreted alkaline phosphatase, SEAP) in a l-arginine-induced manner. All expression units are terminated by a polyadenylation site (pA). Selected restriction sites are indicated: A, AatII; B, BssHII; Ba, BamHI; E, EcoRI; H, HindIII; N, NotI; S, SbfI; X, XbaI, Xh, XhoI. (B) At a low l-arginine concentration (10 mg/l), the ARG1 is in a low-affinity DNA binding state and does not interact with its specific operator sequence (OARG); therefore, expression of the transgene remains silent. At a higher l-arginine concentration (1 g/l), the chimeric transactivator switches to a high-affinity conformation and activates transcription from PhCMVmin upon binding to PART1 through direct ARG1-OARG interaction, thus enabling the transcription of the reporter gene (e.g. SEAP). (C) CHO-K1 were transiently transfected with pSH120 (PSV40-ARG1-pA) and pSH93 (PART1-SEAP-pA) and cultivated for 60 h in medium adjusted to l-arginine concentration ranging from 10 to 1000 mg/l before SEAP production was profiled. The induction factor of SEAP expression is indicated on the top of each bar.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC2175317&req=5

Figure 2: Diagram of the ART regulation system. (A) The bacterial repressor ArgR of Chlamydia pneumoniae, fused to the human NF-κB transactivation domain (ARG1, ArgR-p65), is expressed in a constitutive manner under the control of the simian virus 40 promoter (PSV40). The l-arginine-responsive promoter (PART1) harbors an ArgR-specific operator sequence (OARG, capital letters, ARG boxes underlined) upstream of the minimal version of the cytomegalovirus immediate early promoter (PhCMVmin) and drives expression of a reporter gene (e.g. human secreted alkaline phosphatase, SEAP) in a l-arginine-induced manner. All expression units are terminated by a polyadenylation site (pA). Selected restriction sites are indicated: A, AatII; B, BssHII; Ba, BamHI; E, EcoRI; H, HindIII; N, NotI; S, SbfI; X, XbaI, Xh, XhoI. (B) At a low l-arginine concentration (10 mg/l), the ARG1 is in a low-affinity DNA binding state and does not interact with its specific operator sequence (OARG); therefore, expression of the transgene remains silent. At a higher l-arginine concentration (1 g/l), the chimeric transactivator switches to a high-affinity conformation and activates transcription from PhCMVmin upon binding to PART1 through direct ARG1-OARG interaction, thus enabling the transcription of the reporter gene (e.g. SEAP). (C) CHO-K1 were transiently transfected with pSH120 (PSV40-ARG1-pA) and pSH93 (PART1-SEAP-pA) and cultivated for 60 h in medium adjusted to l-arginine concentration ranging from 10 to 1000 mg/l before SEAP production was profiled. The induction factor of SEAP expression is indicated on the top of each bar.

Mentions: Capitalizing on the ArgR repressor of Chlamydia pneumoniae, which manages arginine metabolism by binding to specific operator sequences (OARG) upstream of the glnPQ operon in a l-arginine-inducible manner, we have designed a l-arginine-regulated transgene control system (ART) which fine-tunes transgene transcription in mammalian cells. ART consists of two components, a l-arginine-regulated transactivator (ARG1) and an ARG1-specific synthetic promoter (PART1): (i) ARG1 was designed by fusing ArgR C-terminally to the human NF-κB transactivation domain (ARG1, ArgR-p65; pSH120, PSV40-ARG1-pA) (8,39). (ii) PART1 was assembled by cloning an ArgR-specific operator module harboring two ARG boxes separated by a single base pair triplet (OARG, AGTTTTCTTGGATTAATTGCATAAATATGATTTCATTATAAATAAATATGCATAAGAGGTCGGAGTG; predicted ARG boxes underlined) 5′ of a minimal version of the human cytomegalovirus immediate early promoter (PhCMVmin; PART1, OARG–PhCMVmin; pSH93, PART1–SEAP-pA; Figure 2A) (15,39). Upon co-transfection of pSH120 (PSV40–ARG1-pA) and pSH93 (PART1–SEAP-pA) into CHO-K1, SEAP expression remained repressed in the presence of 10 mg/l and could be induced by addition of l-arginine up to 1 g/l, suggesting that ARG1 binds and transactivates PART1 in mammalian cells akin to l-arginine-triggered induction of the glnPQ operon by ArgR in Chlamydia pneumoniae (39) (Figure 2B and C).Figure 2.


An engineered L-arginine sensor of Chlamydia pneumoniae enables arginine-adjustable transcription control in mammalian cells and mice.

Hartenbach S, Daoud-El Baba M, Weber W, Fussenegger M - Nucleic Acids Res. (2007)

Diagram of the ART regulation system. (A) The bacterial repressor ArgR of Chlamydia pneumoniae, fused to the human NF-κB transactivation domain (ARG1, ArgR-p65), is expressed in a constitutive manner under the control of the simian virus 40 promoter (PSV40). The l-arginine-responsive promoter (PART1) harbors an ArgR-specific operator sequence (OARG, capital letters, ARG boxes underlined) upstream of the minimal version of the cytomegalovirus immediate early promoter (PhCMVmin) and drives expression of a reporter gene (e.g. human secreted alkaline phosphatase, SEAP) in a l-arginine-induced manner. All expression units are terminated by a polyadenylation site (pA). Selected restriction sites are indicated: A, AatII; B, BssHII; Ba, BamHI; E, EcoRI; H, HindIII; N, NotI; S, SbfI; X, XbaI, Xh, XhoI. (B) At a low l-arginine concentration (10 mg/l), the ARG1 is in a low-affinity DNA binding state and does not interact with its specific operator sequence (OARG); therefore, expression of the transgene remains silent. At a higher l-arginine concentration (1 g/l), the chimeric transactivator switches to a high-affinity conformation and activates transcription from PhCMVmin upon binding to PART1 through direct ARG1-OARG interaction, thus enabling the transcription of the reporter gene (e.g. SEAP). (C) CHO-K1 were transiently transfected with pSH120 (PSV40-ARG1-pA) and pSH93 (PART1-SEAP-pA) and cultivated for 60 h in medium adjusted to l-arginine concentration ranging from 10 to 1000 mg/l before SEAP production was profiled. The induction factor of SEAP expression is indicated on the top of each bar.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC2175317&req=5

Figure 2: Diagram of the ART regulation system. (A) The bacterial repressor ArgR of Chlamydia pneumoniae, fused to the human NF-κB transactivation domain (ARG1, ArgR-p65), is expressed in a constitutive manner under the control of the simian virus 40 promoter (PSV40). The l-arginine-responsive promoter (PART1) harbors an ArgR-specific operator sequence (OARG, capital letters, ARG boxes underlined) upstream of the minimal version of the cytomegalovirus immediate early promoter (PhCMVmin) and drives expression of a reporter gene (e.g. human secreted alkaline phosphatase, SEAP) in a l-arginine-induced manner. All expression units are terminated by a polyadenylation site (pA). Selected restriction sites are indicated: A, AatII; B, BssHII; Ba, BamHI; E, EcoRI; H, HindIII; N, NotI; S, SbfI; X, XbaI, Xh, XhoI. (B) At a low l-arginine concentration (10 mg/l), the ARG1 is in a low-affinity DNA binding state and does not interact with its specific operator sequence (OARG); therefore, expression of the transgene remains silent. At a higher l-arginine concentration (1 g/l), the chimeric transactivator switches to a high-affinity conformation and activates transcription from PhCMVmin upon binding to PART1 through direct ARG1-OARG interaction, thus enabling the transcription of the reporter gene (e.g. SEAP). (C) CHO-K1 were transiently transfected with pSH120 (PSV40-ARG1-pA) and pSH93 (PART1-SEAP-pA) and cultivated for 60 h in medium adjusted to l-arginine concentration ranging from 10 to 1000 mg/l before SEAP production was profiled. The induction factor of SEAP expression is indicated on the top of each bar.
Mentions: Capitalizing on the ArgR repressor of Chlamydia pneumoniae, which manages arginine metabolism by binding to specific operator sequences (OARG) upstream of the glnPQ operon in a l-arginine-inducible manner, we have designed a l-arginine-regulated transgene control system (ART) which fine-tunes transgene transcription in mammalian cells. ART consists of two components, a l-arginine-regulated transactivator (ARG1) and an ARG1-specific synthetic promoter (PART1): (i) ARG1 was designed by fusing ArgR C-terminally to the human NF-κB transactivation domain (ARG1, ArgR-p65; pSH120, PSV40-ARG1-pA) (8,39). (ii) PART1 was assembled by cloning an ArgR-specific operator module harboring two ARG boxes separated by a single base pair triplet (OARG, AGTTTTCTTGGATTAATTGCATAAATATGATTTCATTATAAATAAATATGCATAAGAGGTCGGAGTG; predicted ARG boxes underlined) 5′ of a minimal version of the human cytomegalovirus immediate early promoter (PhCMVmin; PART1, OARG–PhCMVmin; pSH93, PART1–SEAP-pA; Figure 2A) (15,39). Upon co-transfection of pSH120 (PSV40–ARG1-pA) and pSH93 (PART1–SEAP-pA) into CHO-K1, SEAP expression remained repressed in the presence of 10 mg/l and could be induced by addition of l-arginine up to 1 g/l, suggesting that ARG1 binds and transactivates PART1 in mammalian cells akin to l-arginine-triggered induction of the glnPQ operon by ArgR in Chlamydia pneumoniae (39) (Figure 2B and C).Figure 2.

Bottom Line: Arginine-controlled transgene expression showed rapid induction kinetics in a variety of mammalian cell lines and was adjustable and reversible at concentrations which were compatible with host cell physiology.ART variants containing different transactivation domains, variable spacing between ARG box and minimal promoter and several tandem ARG boxes showed modified regulation performance tailored for specific expression scenarios and cell types.Mice implanted with microencapsulated cells engineered for ART-inducible expression of the human placental secreted alkaline phosphatase (SEAP) exhibited adjustable serum phosphatase levels after treatment with different arginine doses.

View Article: PubMed Central - PubMed

Affiliation: Institute for Chemical and Bioengineering, ETH Zurich, Wolfgang-Pauli-Strasse 10, HCI F115, CH-8093 Zurich, Switzerland.

ABSTRACT
For optimal compatibility with biopharmaceutical manufacturing and gene therapy, heterologous transgene control systems must be responsive to side-effect-free physiologic inducer molecules. The arginine-inducible interaction of the ArgR repressor and the ArgR-specific ARG box, which synchronize arginine import and synthesis in the intracellular human pathogen Chlamydia pneumoniae, was engineered for arginine-regulated transgene (ART) expression in mammalian cells. A synthetic arginine-responsive transactivator (ARG), consisting of ArgR fused to the Herpes simplex VP16 transactivation domain, reversibly adjusted transgene transcription of chimeric ARG box-containing mammalian minimal promoters (P(ART)) in an arginine-inducible manner. Arginine-controlled transgene expression showed rapid induction kinetics in a variety of mammalian cell lines and was adjustable and reversible at concentrations which were compatible with host cell physiology. ART variants containing different transactivation domains, variable spacing between ARG box and minimal promoter and several tandem ARG boxes showed modified regulation performance tailored for specific expression scenarios and cell types. Mice implanted with microencapsulated cells engineered for ART-inducible expression of the human placental secreted alkaline phosphatase (SEAP) exhibited adjustable serum phosphatase levels after treatment with different arginine doses. Using a physiologic inducer, such as the amino acid l-arginine, to control heterologous transgenes in a seamless manner which is devoid of noticeable metabolic interference will foster novel opportunities for precise expression dosing in future gene therapy scenarios as well as the manufacturing of difficult-to-produce protein pharmaceuticals.

Show MeSH
Related in: MedlinePlus