Limits...
A novel method for generating and screening peptides and libraries displayed on adenovirus fiber.

Lupold SE, Kudrolli TA, Chowdhury WH, Wu P, Rodriguez R - Nucleic Acids Res. (2007)

Bottom Line: Capsid-displayed adenoviral peptide libraries have been a significant, yet unfeasible goal in biotechnology.The 'acceptor' vector does not contain the fiber gene, and therefore does not propagate until it has received a 'donor' fiber gene.For proof of principal, we use this new system to screen a capsid-displayed peptide library for retargeted viral infection.

View Article: PubMed Central - PubMed

Affiliation: James Buchanan Brady Urology Institute, Johns Hopkins University School of Medicine, Broadway Research Building 467, 733N Broadway, Baltimore, MD 21205, USA. slupold@jhmi.edu

ABSTRACT
Capsid-displayed adenoviral peptide libraries have been a significant, yet unfeasible goal in biotechnology. Three barriers have made this difficult: the large size of the viral genome, the low efficiency of converting plasmid-based genomes into packaged adenovirus and the fact that library amplification is hampered by the ability of two (or more) virus to co-infect one cell. Here, we present a novel vector system, pFex, which is capable of overcoming all three barriers. With pFex, modified fiber genes are recombined into the natural genetic locus of adenovirus through unidirectional Cre-lox recombination. Modified-fiber genes can be directly shuttled into replicating viral genomes in mammalian cells. The 'acceptor' vector does not contain the fiber gene, and therefore does not propagate until it has received a 'donor' fiber gene. Therefore, This methodology overcomes the low efficiency of transfecting large viral genomes and bypasses the need for transition to functional virus. Thus, with a fiber-shuttle library, one can generate and evaluate large numbers of fiber-modified adenovirus simultaneously. Finally, successful fiber genes can be rescued from virus and recombined back into shuttle plasmids, avoiding the need to propagate mixed viral pools. For proof of principal, we use this new system to screen a capsid-displayed peptide library for retargeted viral infection.

Show MeSH

Related in: MedlinePlus

Evaluation of adenovirus generated by the pFex system. (A) Viral burst comparison of pFex derived and AdEasy derived virus, both containing wild-type fiber, demonstrates equal replication and spreading rate as indicated by GFP-positive viral burst size. (B) Equal PFU of purified adenovirus containing wild-type fiber (AdTrack-WTFib), CAR-ablated fiber (ΔTAYT) or CAR ablated and RGD4C retargeted fiber (ΔTAYT-RGD) were boiled and evaluated by western blotting (top gel). Similar fiber quantities and appropriate size are demonstrated. Viral DNA of equal PFU of purified adenovirus was also subjected to PCR to evaluate content, size and homogeneity of the fiber-HI loop region (lower two gels). The larger fiber-PCR band of AdTrack-RGD4C-2 (ΔTAYT-RGD) is caused by the peptide encoding region. AdTrack-FBR2 (ΔTAYT) and AdTrack-WTFib (wild-type) do not contain recombinant HI loop peptides and therefore have identical size HI loop products. Hexon PCR was included as a reference control. (C) PC-3 and PC3-CAR prostate cancer cells were infected with 100 MOI of wild-type, CAR-ablated (ΔTAYT) and CAR-ablated and integrin retargeted (ΔTAYT-RGD) GFP-expressing adenovirus. Infected cells were identified by GFP-positive fluorescent microscopy. As predicted, ΔTAYT mutation completely detargeted virus and inclusion of the integrin targeting peptide, RGD4C, restored viral infection in a CAR independent manner.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC2175307&req=5

Figure 3: Evaluation of adenovirus generated by the pFex system. (A) Viral burst comparison of pFex derived and AdEasy derived virus, both containing wild-type fiber, demonstrates equal replication and spreading rate as indicated by GFP-positive viral burst size. (B) Equal PFU of purified adenovirus containing wild-type fiber (AdTrack-WTFib), CAR-ablated fiber (ΔTAYT) or CAR ablated and RGD4C retargeted fiber (ΔTAYT-RGD) were boiled and evaluated by western blotting (top gel). Similar fiber quantities and appropriate size are demonstrated. Viral DNA of equal PFU of purified adenovirus was also subjected to PCR to evaluate content, size and homogeneity of the fiber-HI loop region (lower two gels). The larger fiber-PCR band of AdTrack-RGD4C-2 (ΔTAYT-RGD) is caused by the peptide encoding region. AdTrack-FBR2 (ΔTAYT) and AdTrack-WTFib (wild-type) do not contain recombinant HI loop peptides and therefore have identical size HI loop products. Hexon PCR was included as a reference control. (C) PC-3 and PC3-CAR prostate cancer cells were infected with 100 MOI of wild-type, CAR-ablated (ΔTAYT) and CAR-ablated and integrin retargeted (ΔTAYT-RGD) GFP-expressing adenovirus. Infected cells were identified by GFP-positive fluorescent microscopy. As predicted, ΔTAYT mutation completely detargeted virus and inclusion of the integrin targeting peptide, RGD4C, restored viral infection in a CAR independent manner.

Mentions: Fiber shuttle vectors were also constructed in a stepwise manner. The pBK-CMV-fiber (a generous gift from Drew Pardoll and Sara Pai, Johns Hopkins) contained three mutations, A32665T, A32667C (which created a unique BspEI site in the fiber-HI loop) and A32651G (N541S ablative mutation). Adenovirus containing the fiber N541S mutation are unable to infect or propagate [Figure 3, far left column 0:1 (WT:N541S) produces no viral bursts or plaques]. The pBK-CMV-fiber was digested with the SpeI and XhoI and the linkers S-lox m2/71-X5 and S-lox m2/71-X3 (Supplementary Table S3) were self-annealed and ligated into the vector creating ‘Step 1 fiber Shuttle Lox m2/71’. The linkers N-Lox 66-A-5 and N-Lox 66-A-3 were then subcloned into this vector by Acc65I and NotI, making ‘RP-Fib1’. The tripartite leader (TPL) splice acceptor site was subcloned downstream of the lox m2/71 site with linkers splce1 and splce 2 creating RP-Fib1R1. For CAR-ablated vectors, pBK-CMV-TAYT-fiber (ΔAd5 nucleotides 32506–32518, amino acids T489AYT492) was subcloned into shuttle through XhoI/NotI, creating ‘RP-Fib2’. The TPL splice acceptor was cloned as above creating ‘RP-Fib2R1’. Finally, plasmids RP-FBR1 and RP-FBR2 were generated by reverting the A32651G (N541S) mutation to wild-type with primers 5FBR-537REP and 3FBR-537REP and BglII and BspEI subcloning. To generate Ampicillin resistant versions, the floxed cassettes were subcloned into Puc19 through KpnI and SpeI, creating RPuc-Fib1, RPuc-Fib2, RPuc-Fib1R1, RPuc-Fib2R1, RPuc-FBr1 and RPuc-FBR2. RPuc-RGD4C-2 was created in two steps. First, annealed primers 5N-Dir and 3N-Dir were subcloned into the HI-loop BspeI site. Linkers 5′RGD and 3′RGD were then annealed and subcloned into the vector. RPuc-WTFib and RP-WTFib, were generated with primers WTFibFix-1 and WTFibFix-2 and subcloning through NcoI and NotI. RPuc-Rescue was generated by PCR amplification of SacB with primers Not-SacB (AATTGCGGCCGCCACTATTATTTAGTGAAATGAGATATTA) and Xho-SacB (ATCTCGAGAGAAGTGATGCACTTTGATATCGACCCAAG) and subsequent cloning into RPuc-FBR1, replacing fiber with SacB.


A novel method for generating and screening peptides and libraries displayed on adenovirus fiber.

Lupold SE, Kudrolli TA, Chowdhury WH, Wu P, Rodriguez R - Nucleic Acids Res. (2007)

Evaluation of adenovirus generated by the pFex system. (A) Viral burst comparison of pFex derived and AdEasy derived virus, both containing wild-type fiber, demonstrates equal replication and spreading rate as indicated by GFP-positive viral burst size. (B) Equal PFU of purified adenovirus containing wild-type fiber (AdTrack-WTFib), CAR-ablated fiber (ΔTAYT) or CAR ablated and RGD4C retargeted fiber (ΔTAYT-RGD) were boiled and evaluated by western blotting (top gel). Similar fiber quantities and appropriate size are demonstrated. Viral DNA of equal PFU of purified adenovirus was also subjected to PCR to evaluate content, size and homogeneity of the fiber-HI loop region (lower two gels). The larger fiber-PCR band of AdTrack-RGD4C-2 (ΔTAYT-RGD) is caused by the peptide encoding region. AdTrack-FBR2 (ΔTAYT) and AdTrack-WTFib (wild-type) do not contain recombinant HI loop peptides and therefore have identical size HI loop products. Hexon PCR was included as a reference control. (C) PC-3 and PC3-CAR prostate cancer cells were infected with 100 MOI of wild-type, CAR-ablated (ΔTAYT) and CAR-ablated and integrin retargeted (ΔTAYT-RGD) GFP-expressing adenovirus. Infected cells were identified by GFP-positive fluorescent microscopy. As predicted, ΔTAYT mutation completely detargeted virus and inclusion of the integrin targeting peptide, RGD4C, restored viral infection in a CAR independent manner.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC2175307&req=5

Figure 3: Evaluation of adenovirus generated by the pFex system. (A) Viral burst comparison of pFex derived and AdEasy derived virus, both containing wild-type fiber, demonstrates equal replication and spreading rate as indicated by GFP-positive viral burst size. (B) Equal PFU of purified adenovirus containing wild-type fiber (AdTrack-WTFib), CAR-ablated fiber (ΔTAYT) or CAR ablated and RGD4C retargeted fiber (ΔTAYT-RGD) were boiled and evaluated by western blotting (top gel). Similar fiber quantities and appropriate size are demonstrated. Viral DNA of equal PFU of purified adenovirus was also subjected to PCR to evaluate content, size and homogeneity of the fiber-HI loop region (lower two gels). The larger fiber-PCR band of AdTrack-RGD4C-2 (ΔTAYT-RGD) is caused by the peptide encoding region. AdTrack-FBR2 (ΔTAYT) and AdTrack-WTFib (wild-type) do not contain recombinant HI loop peptides and therefore have identical size HI loop products. Hexon PCR was included as a reference control. (C) PC-3 and PC3-CAR prostate cancer cells were infected with 100 MOI of wild-type, CAR-ablated (ΔTAYT) and CAR-ablated and integrin retargeted (ΔTAYT-RGD) GFP-expressing adenovirus. Infected cells were identified by GFP-positive fluorescent microscopy. As predicted, ΔTAYT mutation completely detargeted virus and inclusion of the integrin targeting peptide, RGD4C, restored viral infection in a CAR independent manner.
Mentions: Fiber shuttle vectors were also constructed in a stepwise manner. The pBK-CMV-fiber (a generous gift from Drew Pardoll and Sara Pai, Johns Hopkins) contained three mutations, A32665T, A32667C (which created a unique BspEI site in the fiber-HI loop) and A32651G (N541S ablative mutation). Adenovirus containing the fiber N541S mutation are unable to infect or propagate [Figure 3, far left column 0:1 (WT:N541S) produces no viral bursts or plaques]. The pBK-CMV-fiber was digested with the SpeI and XhoI and the linkers S-lox m2/71-X5 and S-lox m2/71-X3 (Supplementary Table S3) were self-annealed and ligated into the vector creating ‘Step 1 fiber Shuttle Lox m2/71’. The linkers N-Lox 66-A-5 and N-Lox 66-A-3 were then subcloned into this vector by Acc65I and NotI, making ‘RP-Fib1’. The tripartite leader (TPL) splice acceptor site was subcloned downstream of the lox m2/71 site with linkers splce1 and splce 2 creating RP-Fib1R1. For CAR-ablated vectors, pBK-CMV-TAYT-fiber (ΔAd5 nucleotides 32506–32518, amino acids T489AYT492) was subcloned into shuttle through XhoI/NotI, creating ‘RP-Fib2’. The TPL splice acceptor was cloned as above creating ‘RP-Fib2R1’. Finally, plasmids RP-FBR1 and RP-FBR2 were generated by reverting the A32651G (N541S) mutation to wild-type with primers 5FBR-537REP and 3FBR-537REP and BglII and BspEI subcloning. To generate Ampicillin resistant versions, the floxed cassettes were subcloned into Puc19 through KpnI and SpeI, creating RPuc-Fib1, RPuc-Fib2, RPuc-Fib1R1, RPuc-Fib2R1, RPuc-FBr1 and RPuc-FBR2. RPuc-RGD4C-2 was created in two steps. First, annealed primers 5N-Dir and 3N-Dir were subcloned into the HI-loop BspeI site. Linkers 5′RGD and 3′RGD were then annealed and subcloned into the vector. RPuc-WTFib and RP-WTFib, were generated with primers WTFibFix-1 and WTFibFix-2 and subcloning through NcoI and NotI. RPuc-Rescue was generated by PCR amplification of SacB with primers Not-SacB (AATTGCGGCCGCCACTATTATTTAGTGAAATGAGATATTA) and Xho-SacB (ATCTCGAGAGAAGTGATGCACTTTGATATCGACCCAAG) and subsequent cloning into RPuc-FBR1, replacing fiber with SacB.

Bottom Line: Capsid-displayed adenoviral peptide libraries have been a significant, yet unfeasible goal in biotechnology.The 'acceptor' vector does not contain the fiber gene, and therefore does not propagate until it has received a 'donor' fiber gene.For proof of principal, we use this new system to screen a capsid-displayed peptide library for retargeted viral infection.

View Article: PubMed Central - PubMed

Affiliation: James Buchanan Brady Urology Institute, Johns Hopkins University School of Medicine, Broadway Research Building 467, 733N Broadway, Baltimore, MD 21205, USA. slupold@jhmi.edu

ABSTRACT
Capsid-displayed adenoviral peptide libraries have been a significant, yet unfeasible goal in biotechnology. Three barriers have made this difficult: the large size of the viral genome, the low efficiency of converting plasmid-based genomes into packaged adenovirus and the fact that library amplification is hampered by the ability of two (or more) virus to co-infect one cell. Here, we present a novel vector system, pFex, which is capable of overcoming all three barriers. With pFex, modified fiber genes are recombined into the natural genetic locus of adenovirus through unidirectional Cre-lox recombination. Modified-fiber genes can be directly shuttled into replicating viral genomes in mammalian cells. The 'acceptor' vector does not contain the fiber gene, and therefore does not propagate until it has received a 'donor' fiber gene. Therefore, This methodology overcomes the low efficiency of transfecting large viral genomes and bypasses the need for transition to functional virus. Thus, with a fiber-shuttle library, one can generate and evaluate large numbers of fiber-modified adenovirus simultaneously. Finally, successful fiber genes can be rescued from virus and recombined back into shuttle plasmids, avoiding the need to propagate mixed viral pools. For proof of principal, we use this new system to screen a capsid-displayed peptide library for retargeted viral infection.

Show MeSH
Related in: MedlinePlus