Limits...
A novel method for generating and screening peptides and libraries displayed on adenovirus fiber.

Lupold SE, Kudrolli TA, Chowdhury WH, Wu P, Rodriguez R - Nucleic Acids Res. (2007)

Bottom Line: Capsid-displayed adenoviral peptide libraries have been a significant, yet unfeasible goal in biotechnology.The 'acceptor' vector does not contain the fiber gene, and therefore does not propagate until it has received a 'donor' fiber gene.For proof of principal, we use this new system to screen a capsid-displayed peptide library for retargeted viral infection.

View Article: PubMed Central - PubMed

Affiliation: James Buchanan Brady Urology Institute, Johns Hopkins University School of Medicine, Broadway Research Building 467, 733N Broadway, Baltimore, MD 21205, USA. slupold@jhmi.edu

ABSTRACT
Capsid-displayed adenoviral peptide libraries have been a significant, yet unfeasible goal in biotechnology. Three barriers have made this difficult: the large size of the viral genome, the low efficiency of converting plasmid-based genomes into packaged adenovirus and the fact that library amplification is hampered by the ability of two (or more) virus to co-infect one cell. Here, we present a novel vector system, pFex, which is capable of overcoming all three barriers. With pFex, modified fiber genes are recombined into the natural genetic locus of adenovirus through unidirectional Cre-lox recombination. Modified-fiber genes can be directly shuttled into replicating viral genomes in mammalian cells. The 'acceptor' vector does not contain the fiber gene, and therefore does not propagate until it has received a 'donor' fiber gene. Therefore, This methodology overcomes the low efficiency of transfecting large viral genomes and bypasses the need for transition to functional virus. Thus, with a fiber-shuttle library, one can generate and evaluate large numbers of fiber-modified adenovirus simultaneously. Finally, successful fiber genes can be rescued from virus and recombined back into shuttle plasmids, avoiding the need to propagate mixed viral pools. For proof of principal, we use this new system to screen a capsid-displayed peptide library for retargeted viral infection.

Show MeSH

Related in: MedlinePlus

E1 and fiber cassette exchange in plasmid vectors. (A) PacI restriction digestion of parental vector, pFex, and resulting recombinant vectors pAdTrack-Fex and pAdTrack-Luc-Fex following E1 cassette exchange in BJ5183 E. coli. The corresponding E1 Cassettes contain an additional PacI site, which results in the diagnostic 4.6 Kb band (arrow). (B) PCR across a single lox site of 294cre clones demonstrates the presence of fiber containing pFex (5′-primer within fiber gene and 3′-primer within pFex). The shuttle control does not contain lox sites and therefore does not recombine with pFex. On the other hand, PCR within the pFex vector demonstrates presence of the ‘acceptor’ pFex in both RP-Fib and shuttle-control samples. (C) XhoI restriction digest of 12 mini-preps randomly screened for the presence of the desired fiber-containing clone following fiber cassette exchange into pFex. The fiber gene contains an additional XhoI site, which generates the diagnostic 3.6 Kb product (arrow). All of the screened clones contained the desired plasmid product.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC2175307&req=5

Figure 2: E1 and fiber cassette exchange in plasmid vectors. (A) PacI restriction digestion of parental vector, pFex, and resulting recombinant vectors pAdTrack-Fex and pAdTrack-Luc-Fex following E1 cassette exchange in BJ5183 E. coli. The corresponding E1 Cassettes contain an additional PacI site, which results in the diagnostic 4.6 Kb band (arrow). (B) PCR across a single lox site of 294cre clones demonstrates the presence of fiber containing pFex (5′-primer within fiber gene and 3′-primer within pFex). The shuttle control does not contain lox sites and therefore does not recombine with pFex. On the other hand, PCR within the pFex vector demonstrates presence of the ‘acceptor’ pFex in both RP-Fib and shuttle-control samples. (C) XhoI restriction digest of 12 mini-preps randomly screened for the presence of the desired fiber-containing clone following fiber cassette exchange into pFex. The fiber gene contains an additional XhoI site, which generates the diagnostic 3.6 Kb product (arrow). All of the screened clones contained the desired plasmid product.

Mentions: The pAdTrack was recombined with the pFex plasmid vector either before or after fiber-region recombination in BJ5183 E. coli either by co-electroporation or by first generating a stable pFex-based BJ5183 coli followed by electroporation of the AdTrack shuttle vector (13,14). Recombinant vectors were propagated in DH5α. For fiber-region recombination, 10 ng of pFex was transformed with the 10 ng fiber shuttle vector into 40 μl of electrocompetent 294cre coli (Gene Bridges GmbH, Dresden, Germany) in a 0.2 cm cuvette at 2.5 KV, 200 ohms and 25 μFd (BioRad Gene Pulser). Following electroporation, samples were resuspended in 1.0 ml SOC broth, incubated at 42°C for 20 min and then shook vertically (225 rpm) at 37°C for 1 h. Recombinant plasmids were selected on appropriate antibiotic LB agar plates containing 5–7% sucrose. Clones were amplified, mini-prepped and the resulting plasmid electroporated into DH5α coli. In some cases, PCR was applied prior to DH5α transformation to detect the presence of recombinant clones (see ‘Recombination-specific PCR’ section subsequently and Figure 2B). Recombinant plasmids were screened by XhoI restriction mapping and confirmed by DNA sequencing. Viral plasmid products were linearized by PacI digestion and transfected into the desired packaging lines (293 or 911–S11). Viruses were step amplified to 5 × 150 mm2 flasks and then purified by commercial adenovirus purification kit (Adenopure™, Puresyn, Inc., Malvern, PA, USA). Benzonase was used in the purification process. Resulting virus were titered by Adeno-X™ Rapid Titer Kit (BD Biosciences). The correct splicing pattern upstream of the recombinant fiber gene was confirmed by reverse transcription of total RNA harvested from infected cells (Trizol, Invitrogen), followed by PCR amplification with primers Fib-RT1 (ACAAACUCUUCGCGGUCUUU) and Fib-RT2 (UAUCUUCAGACGGUCUUGCG), TOPO-TA cloning (pCR-21-TOPO, InVitrogen) and sequencing. These results confirmed natural linkage of the TPL to the fiber coding region.


A novel method for generating and screening peptides and libraries displayed on adenovirus fiber.

Lupold SE, Kudrolli TA, Chowdhury WH, Wu P, Rodriguez R - Nucleic Acids Res. (2007)

E1 and fiber cassette exchange in plasmid vectors. (A) PacI restriction digestion of parental vector, pFex, and resulting recombinant vectors pAdTrack-Fex and pAdTrack-Luc-Fex following E1 cassette exchange in BJ5183 E. coli. The corresponding E1 Cassettes contain an additional PacI site, which results in the diagnostic 4.6 Kb band (arrow). (B) PCR across a single lox site of 294cre clones demonstrates the presence of fiber containing pFex (5′-primer within fiber gene and 3′-primer within pFex). The shuttle control does not contain lox sites and therefore does not recombine with pFex. On the other hand, PCR within the pFex vector demonstrates presence of the ‘acceptor’ pFex in both RP-Fib and shuttle-control samples. (C) XhoI restriction digest of 12 mini-preps randomly screened for the presence of the desired fiber-containing clone following fiber cassette exchange into pFex. The fiber gene contains an additional XhoI site, which generates the diagnostic 3.6 Kb product (arrow). All of the screened clones contained the desired plasmid product.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC2175307&req=5

Figure 2: E1 and fiber cassette exchange in plasmid vectors. (A) PacI restriction digestion of parental vector, pFex, and resulting recombinant vectors pAdTrack-Fex and pAdTrack-Luc-Fex following E1 cassette exchange in BJ5183 E. coli. The corresponding E1 Cassettes contain an additional PacI site, which results in the diagnostic 4.6 Kb band (arrow). (B) PCR across a single lox site of 294cre clones demonstrates the presence of fiber containing pFex (5′-primer within fiber gene and 3′-primer within pFex). The shuttle control does not contain lox sites and therefore does not recombine with pFex. On the other hand, PCR within the pFex vector demonstrates presence of the ‘acceptor’ pFex in both RP-Fib and shuttle-control samples. (C) XhoI restriction digest of 12 mini-preps randomly screened for the presence of the desired fiber-containing clone following fiber cassette exchange into pFex. The fiber gene contains an additional XhoI site, which generates the diagnostic 3.6 Kb product (arrow). All of the screened clones contained the desired plasmid product.
Mentions: The pAdTrack was recombined with the pFex plasmid vector either before or after fiber-region recombination in BJ5183 E. coli either by co-electroporation or by first generating a stable pFex-based BJ5183 coli followed by electroporation of the AdTrack shuttle vector (13,14). Recombinant vectors were propagated in DH5α. For fiber-region recombination, 10 ng of pFex was transformed with the 10 ng fiber shuttle vector into 40 μl of electrocompetent 294cre coli (Gene Bridges GmbH, Dresden, Germany) in a 0.2 cm cuvette at 2.5 KV, 200 ohms and 25 μFd (BioRad Gene Pulser). Following electroporation, samples were resuspended in 1.0 ml SOC broth, incubated at 42°C for 20 min and then shook vertically (225 rpm) at 37°C for 1 h. Recombinant plasmids were selected on appropriate antibiotic LB agar plates containing 5–7% sucrose. Clones were amplified, mini-prepped and the resulting plasmid electroporated into DH5α coli. In some cases, PCR was applied prior to DH5α transformation to detect the presence of recombinant clones (see ‘Recombination-specific PCR’ section subsequently and Figure 2B). Recombinant plasmids were screened by XhoI restriction mapping and confirmed by DNA sequencing. Viral plasmid products were linearized by PacI digestion and transfected into the desired packaging lines (293 or 911–S11). Viruses were step amplified to 5 × 150 mm2 flasks and then purified by commercial adenovirus purification kit (Adenopure™, Puresyn, Inc., Malvern, PA, USA). Benzonase was used in the purification process. Resulting virus were titered by Adeno-X™ Rapid Titer Kit (BD Biosciences). The correct splicing pattern upstream of the recombinant fiber gene was confirmed by reverse transcription of total RNA harvested from infected cells (Trizol, Invitrogen), followed by PCR amplification with primers Fib-RT1 (ACAAACUCUUCGCGGUCUUU) and Fib-RT2 (UAUCUUCAGACGGUCUUGCG), TOPO-TA cloning (pCR-21-TOPO, InVitrogen) and sequencing. These results confirmed natural linkage of the TPL to the fiber coding region.

Bottom Line: Capsid-displayed adenoviral peptide libraries have been a significant, yet unfeasible goal in biotechnology.The 'acceptor' vector does not contain the fiber gene, and therefore does not propagate until it has received a 'donor' fiber gene.For proof of principal, we use this new system to screen a capsid-displayed peptide library for retargeted viral infection.

View Article: PubMed Central - PubMed

Affiliation: James Buchanan Brady Urology Institute, Johns Hopkins University School of Medicine, Broadway Research Building 467, 733N Broadway, Baltimore, MD 21205, USA. slupold@jhmi.edu

ABSTRACT
Capsid-displayed adenoviral peptide libraries have been a significant, yet unfeasible goal in biotechnology. Three barriers have made this difficult: the large size of the viral genome, the low efficiency of converting plasmid-based genomes into packaged adenovirus and the fact that library amplification is hampered by the ability of two (or more) virus to co-infect one cell. Here, we present a novel vector system, pFex, which is capable of overcoming all three barriers. With pFex, modified fiber genes are recombined into the natural genetic locus of adenovirus through unidirectional Cre-lox recombination. Modified-fiber genes can be directly shuttled into replicating viral genomes in mammalian cells. The 'acceptor' vector does not contain the fiber gene, and therefore does not propagate until it has received a 'donor' fiber gene. Therefore, This methodology overcomes the low efficiency of transfecting large viral genomes and bypasses the need for transition to functional virus. Thus, with a fiber-shuttle library, one can generate and evaluate large numbers of fiber-modified adenovirus simultaneously. Finally, successful fiber genes can be rescued from virus and recombined back into shuttle plasmids, avoiding the need to propagate mixed viral pools. For proof of principal, we use this new system to screen a capsid-displayed peptide library for retargeted viral infection.

Show MeSH
Related in: MedlinePlus