Limits...
A proteasome cap subunit required for spindle pole body duplication in yeast.

McDonald HB, Byers B - J. Cell Biol. (1997)

Bottom Line: Biol.EM reveals that each arrested pcs1 cell has failed to duplicate its spindle pole body (SPB), which becomes enlarged as in other monopolar mutants.We hypothesize that Pcs1p plays a role in the degradation of certain potentially nuclear component(s) in a manner that specifically is required for SPB duplication.

View Article: PubMed Central - PubMed

Affiliation: Department of Genetics, University of Washington, Seattle 98195, USA.

ABSTRACT
Proteasome-mediated protein degradation is a key regulatory mechanism in a diversity of complex processes, including the control of cell cycle progression. The selection of substrates for degradation clearly depends on the specificity of ubiquitination mechanisms, but further regulation may occur within the proteasomal 19S cap complexes, which attach to the ends of the 20S proteolytic core and are thought to control entry of substrates into the core. We have characterized a gene from Saccharomyces cerevisiae that displays extensive sequence similarity to members of a family of ATPases that are components of the 19S complex, including human subunit p42 and S. cerevisiae SUG1/CIM3 and CIM5 products. This gene, termed PCS1 (for proteasomal cap subunit), is identical to the recently described SUG2 gene (Russell, S.J., U.G. Sathyanarayana, and S.A. Johnston. 1996. J. Biol. Chem. 271:32810-32817). We have shown that PCS1 function is essential for viability. A temperature-sensitive pcs1 strain arrests principally in the second cycle after transfer to the restrictive temperature, blocking as large-budded cells with a G2 content of unsegregated DNA. EM reveals that each arrested pcs1 cell has failed to duplicate its spindle pole body (SPB), which becomes enlarged as in other monopolar mutants. Additionally, we have shown localization of a functional Pcs1-green fluorescent protein fusion to the nucleus throughout the cell cycle. We hypothesize that Pcs1p plays a role in the degradation of certain potentially nuclear component(s) in a manner that specifically is required for SPB duplication.

Show MeSH

Related in: MedlinePlus

Organization and sequence analysis of  the PCS1 gene. (A) Partial restriction map of the  genomic region surrounding PCS1. The PCS1  and CDC31 coding regions are indicated by arrows beneath the map; ORF indicates a third  open reading frame. The line above the map represents the sequenced region shown in B; this region is sufficient to supply PCS1 function in cells  lacking other functional copies of the gene. H,  HindIII; B, BamHI; R, EcoRI. (B) Nucleotide  and predicted amino acid sequence of PCS1. A  potential nuclear localization signal is boxed; a  heptad repeat characteristic of α-helical coiledcoils is indicated by triangles; sequence motifs  characteristic of an ATP-binding domain are underlined; and the site of gene disruption described in the text is indicated by an arrow under  the first ATP motif. These sequence data are  available from GenBank/EMBL/DDBJ under  accession number U93262. The PCS1 sequence  is also entered in these databases as SUG2 (accession number SCU43720 [GB]) (83) and in the  S. cerevisiae genome database by J.H. McCusker  (Duke University Medical Center, Durham, NC)  and J.E. Haber (Brandeis University, Waltham,  MA) as representing CRL13, which was originally identified by a temperature-sensitive, cycloheximide-resistant allele (65). (C) Structural  analysis of Pcs1p. The top line is a graphical representation of the relative hydrophilicity of its  amino acid sequence (57). The next three lines  represent secondary structural predictions calculated by the method of Garnier et al. (29) and  displayed in graphical form. Regions predicted  to form turns, α helices, or β sheets are indicated  by elevation of the appropriate line.
© Copyright Policy
Related In: Results  -  Collection


getmorefigures.php?uid=PMC2139890&req=5

Figure 2: Organization and sequence analysis of the PCS1 gene. (A) Partial restriction map of the genomic region surrounding PCS1. The PCS1 and CDC31 coding regions are indicated by arrows beneath the map; ORF indicates a third open reading frame. The line above the map represents the sequenced region shown in B; this region is sufficient to supply PCS1 function in cells lacking other functional copies of the gene. H, HindIII; B, BamHI; R, EcoRI. (B) Nucleotide and predicted amino acid sequence of PCS1. A potential nuclear localization signal is boxed; a heptad repeat characteristic of α-helical coiledcoils is indicated by triangles; sequence motifs characteristic of an ATP-binding domain are underlined; and the site of gene disruption described in the text is indicated by an arrow under the first ATP motif. These sequence data are available from GenBank/EMBL/DDBJ under accession number U93262. The PCS1 sequence is also entered in these databases as SUG2 (accession number SCU43720 [GB]) (83) and in the S. cerevisiae genome database by J.H. McCusker (Duke University Medical Center, Durham, NC) and J.E. Haber (Brandeis University, Waltham, MA) as representing CRL13, which was originally identified by a temperature-sensitive, cycloheximide-resistant allele (65). (C) Structural analysis of Pcs1p. The top line is a graphical representation of the relative hydrophilicity of its amino acid sequence (57). The next three lines represent secondary structural predictions calculated by the method of Garnier et al. (29) and displayed in graphical form. Regions predicted to form turns, α helices, or β sheets are indicated by elevation of the appropriate line.

Mentions: As a first step toward disrupting PCS1, the yeast integrating plasmids pHM35 and pHM47 were constructed. Standard recombinant DNA techniques were used (84), and restriction enzymes, DNA polymerases, and T4 DNA ligase were purchased from New England Biolabs (Beverly, MA). To introduce a unique EcoRI site in the region of the gene encoding the ATPase domain, oligonucleotide primers hm15-BamHI (5′GAAGATCTCGGATCCACTGGTG3′) and hm16-EcoRI (5′GGAATTCTATAACCTCCCTTAA3′) (underlined nucleotides represent restriction sites) were used together with Vent™ DNA polymerase (New England Biolabs) to amplify YL2-29 template DNA between nucleotides 583 and 689 (see Fig. 2 B) in a PCR. The product was digested with BamHI and EcoRI and ligated into BamHI/EcoRI-digested pRS306 (88) to create plasmid pHM34. Primers hm17-EcoRI (5′CGAATTCCCATTGAAGAACCCAG3′) and hm18-KpnI (5′CCGGTACCAGGGGGAC3′) were used to amplify the YL2-29 template between nucleotides 685 and 775. This product was digested with EcoRI and KpnI and ligated into EcoRI/KpnI- digested pHM34 to create pHM35. The insert in pHM35 was excised with BamHI and KpnI and ligated into BamHI/KpnI-digested pRS304 (88) to create pHM47.


A proteasome cap subunit required for spindle pole body duplication in yeast.

McDonald HB, Byers B - J. Cell Biol. (1997)

Organization and sequence analysis of  the PCS1 gene. (A) Partial restriction map of the  genomic region surrounding PCS1. The PCS1  and CDC31 coding regions are indicated by arrows beneath the map; ORF indicates a third  open reading frame. The line above the map represents the sequenced region shown in B; this region is sufficient to supply PCS1 function in cells  lacking other functional copies of the gene. H,  HindIII; B, BamHI; R, EcoRI. (B) Nucleotide  and predicted amino acid sequence of PCS1. A  potential nuclear localization signal is boxed; a  heptad repeat characteristic of α-helical coiledcoils is indicated by triangles; sequence motifs  characteristic of an ATP-binding domain are underlined; and the site of gene disruption described in the text is indicated by an arrow under  the first ATP motif. These sequence data are  available from GenBank/EMBL/DDBJ under  accession number U93262. The PCS1 sequence  is also entered in these databases as SUG2 (accession number SCU43720 [GB]) (83) and in the  S. cerevisiae genome database by J.H. McCusker  (Duke University Medical Center, Durham, NC)  and J.E. Haber (Brandeis University, Waltham,  MA) as representing CRL13, which was originally identified by a temperature-sensitive, cycloheximide-resistant allele (65). (C) Structural  analysis of Pcs1p. The top line is a graphical representation of the relative hydrophilicity of its  amino acid sequence (57). The next three lines  represent secondary structural predictions calculated by the method of Garnier et al. (29) and  displayed in graphical form. Regions predicted  to form turns, α helices, or β sheets are indicated  by elevation of the appropriate line.
© Copyright Policy
Related In: Results  -  Collection

Show All Figures
getmorefigures.php?uid=PMC2139890&req=5

Figure 2: Organization and sequence analysis of the PCS1 gene. (A) Partial restriction map of the genomic region surrounding PCS1. The PCS1 and CDC31 coding regions are indicated by arrows beneath the map; ORF indicates a third open reading frame. The line above the map represents the sequenced region shown in B; this region is sufficient to supply PCS1 function in cells lacking other functional copies of the gene. H, HindIII; B, BamHI; R, EcoRI. (B) Nucleotide and predicted amino acid sequence of PCS1. A potential nuclear localization signal is boxed; a heptad repeat characteristic of α-helical coiledcoils is indicated by triangles; sequence motifs characteristic of an ATP-binding domain are underlined; and the site of gene disruption described in the text is indicated by an arrow under the first ATP motif. These sequence data are available from GenBank/EMBL/DDBJ under accession number U93262. The PCS1 sequence is also entered in these databases as SUG2 (accession number SCU43720 [GB]) (83) and in the S. cerevisiae genome database by J.H. McCusker (Duke University Medical Center, Durham, NC) and J.E. Haber (Brandeis University, Waltham, MA) as representing CRL13, which was originally identified by a temperature-sensitive, cycloheximide-resistant allele (65). (C) Structural analysis of Pcs1p. The top line is a graphical representation of the relative hydrophilicity of its amino acid sequence (57). The next three lines represent secondary structural predictions calculated by the method of Garnier et al. (29) and displayed in graphical form. Regions predicted to form turns, α helices, or β sheets are indicated by elevation of the appropriate line.
Mentions: As a first step toward disrupting PCS1, the yeast integrating plasmids pHM35 and pHM47 were constructed. Standard recombinant DNA techniques were used (84), and restriction enzymes, DNA polymerases, and T4 DNA ligase were purchased from New England Biolabs (Beverly, MA). To introduce a unique EcoRI site in the region of the gene encoding the ATPase domain, oligonucleotide primers hm15-BamHI (5′GAAGATCTCGGATCCACTGGTG3′) and hm16-EcoRI (5′GGAATTCTATAACCTCCCTTAA3′) (underlined nucleotides represent restriction sites) were used together with Vent™ DNA polymerase (New England Biolabs) to amplify YL2-29 template DNA between nucleotides 583 and 689 (see Fig. 2 B) in a PCR. The product was digested with BamHI and EcoRI and ligated into BamHI/EcoRI-digested pRS306 (88) to create plasmid pHM34. Primers hm17-EcoRI (5′CGAATTCCCATTGAAGAACCCAG3′) and hm18-KpnI (5′CCGGTACCAGGGGGAC3′) were used to amplify the YL2-29 template between nucleotides 685 and 775. This product was digested with EcoRI and KpnI and ligated into EcoRI/KpnI- digested pHM34 to create pHM35. The insert in pHM35 was excised with BamHI and KpnI and ligated into BamHI/KpnI-digested pRS304 (88) to create pHM47.

Bottom Line: Biol.EM reveals that each arrested pcs1 cell has failed to duplicate its spindle pole body (SPB), which becomes enlarged as in other monopolar mutants.We hypothesize that Pcs1p plays a role in the degradation of certain potentially nuclear component(s) in a manner that specifically is required for SPB duplication.

View Article: PubMed Central - PubMed

Affiliation: Department of Genetics, University of Washington, Seattle 98195, USA.

ABSTRACT
Proteasome-mediated protein degradation is a key regulatory mechanism in a diversity of complex processes, including the control of cell cycle progression. The selection of substrates for degradation clearly depends on the specificity of ubiquitination mechanisms, but further regulation may occur within the proteasomal 19S cap complexes, which attach to the ends of the 20S proteolytic core and are thought to control entry of substrates into the core. We have characterized a gene from Saccharomyces cerevisiae that displays extensive sequence similarity to members of a family of ATPases that are components of the 19S complex, including human subunit p42 and S. cerevisiae SUG1/CIM3 and CIM5 products. This gene, termed PCS1 (for proteasomal cap subunit), is identical to the recently described SUG2 gene (Russell, S.J., U.G. Sathyanarayana, and S.A. Johnston. 1996. J. Biol. Chem. 271:32810-32817). We have shown that PCS1 function is essential for viability. A temperature-sensitive pcs1 strain arrests principally in the second cycle after transfer to the restrictive temperature, blocking as large-budded cells with a G2 content of unsegregated DNA. EM reveals that each arrested pcs1 cell has failed to duplicate its spindle pole body (SPB), which becomes enlarged as in other monopolar mutants. Additionally, we have shown localization of a functional Pcs1-green fluorescent protein fusion to the nucleus throughout the cell cycle. We hypothesize that Pcs1p plays a role in the degradation of certain potentially nuclear component(s) in a manner that specifically is required for SPB duplication.

Show MeSH
Related in: MedlinePlus