Limits...
SOI1 encodes a novel, conserved protein that promotes TGN-endosomal cycling of Kex2p and other membrane proteins by modulating the function of two TGN localization signals.

Brickner JH, Fuller RS - J. Cell Biol. (1997)

Bottom Line: Deletion of SOI1 improved retention of Tyr713Ala Kex2p in the pro-alpha-factor processing compartment but, unlike the original soi1 alleles, did not increase the half-life of Tyr713Ala Kex2p.This hypothesis was confirmed in several ways.TLS2 delayed exit of Kex2p from the TGN, whereas TLS1 did not affect this step.

View Article: PubMed Central - PubMed

Affiliation: Department of Biological Chemistry, University of Michigan Medical School, Ann Arbor 48109-0606, USA.

ABSTRACT
Localization of yeast Kex2 protease to the TGN requires a signal (TLS1) in its cytosolic tail (C-tail). Mutation of TLS1 results in rapid transit of Kex2p to the vacuole. Isolation of suppressors of the Tyr713Ala mutation in TLS1 previously identified three SOI genes. SOI1, cloned by complementation of a sporulation defect, encodes a novel, hydrophilic 3,144-residue protein with homologues in Caenorhabditis elegans, Drosophila melanogaster, and humans. Epitope-tagged Soi1p existed in a detergent-insensitive, sedimentable form. Deletion of SOI1 impaired TGN localization of wild-type Kex2p and a fusion protein containing the C-tail of Ste13p, and also caused missorting of carboxypeptidase Y and accelerated vacuolar degradation of the Vps10p sorting receptor. Deletion of SOI1 improved retention of Tyr713Ala Kex2p in the pro-alpha-factor processing compartment but, unlike the original soi1 alleles, did not increase the half-life of Tyr713Ala Kex2p. These results suggested that Soi1p functions at two steps in the cycling of Kex2p and other proteins between the TGN and prevacuolar compartment (PVC). This hypothesis was confirmed in several ways. Soi1p was shown to be required for optimal function of TLS1. Suppression of the Tyr713Ala mutation by mutation of SOI1 was shown to be caused by activation of a second signal (TLS2) in the Kex2p C-tail. TLS2 delayed exit of Kex2p from the TGN, whereas TLS1 did not affect this step. We propose that Soi1p promotes cycling of TGN membrane proteins between the TGN and PVC by antagonizing a TGN retention signal (TLS2) and facilitating the function of a retrieval signal (TLS1) that acts at the PVC.

Show MeSH

Related in: MedlinePlus

Schematic of mutations in the Kex2p cytosolic tail  (C-tail). The positions of mutations in various forms of Kex2p  that were used in this study are indicated. The Y713A (55) and  I718tail (34) mutations have been described. TMD, transmembrane domain.
© Copyright Policy
Related In: Results  -  Collection


getmorefigures.php?uid=PMC2139830&req=5

Figure 1: Schematic of mutations in the Kex2p cytosolic tail (C-tail). The positions of mutations in various forms of Kex2p that were used in this study are indicated. The Y713A (55) and I718tail (34) mutations have been described. TMD, transmembrane domain.

Mentions: Mutations in the C-tail of Kex2p (shown schematically in Fig. 1) were introduced by two-step PCR using mutagenic primers (1). PCR-amplified mutant fragments and pCWKX20-D719Amb (34), which had been gapped with NarI and SnaBI, were cotransformed into yeast (4). Plasmids were retrieved from transformants into E. coli, and mutations were confirmed by DNA sequencing. The primers used were (number 1 = sense strand, number 2 = antisense strand): 737tail (P738Stop), 1) ATTACTGAGTGATCAGAGGTTGAG, 2) CTCAACCTCTGATCACTCAGTAAT; 757tail (S758Stop), 1) GCAAGTTTGTGATCATCAGAA, 2) TTCTGATGATCACAAACTTGC; 778tail (F779Stop), 1) AACGAAAATTCATGAAGTGACCCT, 2) AGGGTCACTTCATGAATTTTCGTT; Y713A I718tail, 1) AGAGCGGAAACGGCTGAGTTCGATATCATT, 2) AATGATATCGAACTCAGCCGTTTCCGCTCT; 763tail (D764Stop), 1) CATCAGAAAACTGAGATGCTGAAC, 2) GTTCAGCATCTCAGTTTTCTGATG; 772tail (L773Stop), 1) GATAGTGTATGAACAAACGAAAATCC, 2) GGATTTTCGTTTGTTCATACACTATC.


SOI1 encodes a novel, conserved protein that promotes TGN-endosomal cycling of Kex2p and other membrane proteins by modulating the function of two TGN localization signals.

Brickner JH, Fuller RS - J. Cell Biol. (1997)

Schematic of mutations in the Kex2p cytosolic tail  (C-tail). The positions of mutations in various forms of Kex2p  that were used in this study are indicated. The Y713A (55) and  I718tail (34) mutations have been described. TMD, transmembrane domain.
© Copyright Policy
Related In: Results  -  Collection

Show All Figures
getmorefigures.php?uid=PMC2139830&req=5

Figure 1: Schematic of mutations in the Kex2p cytosolic tail (C-tail). The positions of mutations in various forms of Kex2p that were used in this study are indicated. The Y713A (55) and I718tail (34) mutations have been described. TMD, transmembrane domain.
Mentions: Mutations in the C-tail of Kex2p (shown schematically in Fig. 1) were introduced by two-step PCR using mutagenic primers (1). PCR-amplified mutant fragments and pCWKX20-D719Amb (34), which had been gapped with NarI and SnaBI, were cotransformed into yeast (4). Plasmids were retrieved from transformants into E. coli, and mutations were confirmed by DNA sequencing. The primers used were (number 1 = sense strand, number 2 = antisense strand): 737tail (P738Stop), 1) ATTACTGAGTGATCAGAGGTTGAG, 2) CTCAACCTCTGATCACTCAGTAAT; 757tail (S758Stop), 1) GCAAGTTTGTGATCATCAGAA, 2) TTCTGATGATCACAAACTTGC; 778tail (F779Stop), 1) AACGAAAATTCATGAAGTGACCCT, 2) AGGGTCACTTCATGAATTTTCGTT; Y713A I718tail, 1) AGAGCGGAAACGGCTGAGTTCGATATCATT, 2) AATGATATCGAACTCAGCCGTTTCCGCTCT; 763tail (D764Stop), 1) CATCAGAAAACTGAGATGCTGAAC, 2) GTTCAGCATCTCAGTTTTCTGATG; 772tail (L773Stop), 1) GATAGTGTATGAACAAACGAAAATCC, 2) GGATTTTCGTTTGTTCATACACTATC.

Bottom Line: Deletion of SOI1 improved retention of Tyr713Ala Kex2p in the pro-alpha-factor processing compartment but, unlike the original soi1 alleles, did not increase the half-life of Tyr713Ala Kex2p.This hypothesis was confirmed in several ways.TLS2 delayed exit of Kex2p from the TGN, whereas TLS1 did not affect this step.

View Article: PubMed Central - PubMed

Affiliation: Department of Biological Chemistry, University of Michigan Medical School, Ann Arbor 48109-0606, USA.

ABSTRACT
Localization of yeast Kex2 protease to the TGN requires a signal (TLS1) in its cytosolic tail (C-tail). Mutation of TLS1 results in rapid transit of Kex2p to the vacuole. Isolation of suppressors of the Tyr713Ala mutation in TLS1 previously identified three SOI genes. SOI1, cloned by complementation of a sporulation defect, encodes a novel, hydrophilic 3,144-residue protein with homologues in Caenorhabditis elegans, Drosophila melanogaster, and humans. Epitope-tagged Soi1p existed in a detergent-insensitive, sedimentable form. Deletion of SOI1 impaired TGN localization of wild-type Kex2p and a fusion protein containing the C-tail of Ste13p, and also caused missorting of carboxypeptidase Y and accelerated vacuolar degradation of the Vps10p sorting receptor. Deletion of SOI1 improved retention of Tyr713Ala Kex2p in the pro-alpha-factor processing compartment but, unlike the original soi1 alleles, did not increase the half-life of Tyr713Ala Kex2p. These results suggested that Soi1p functions at two steps in the cycling of Kex2p and other proteins between the TGN and prevacuolar compartment (PVC). This hypothesis was confirmed in several ways. Soi1p was shown to be required for optimal function of TLS1. Suppression of the Tyr713Ala mutation by mutation of SOI1 was shown to be caused by activation of a second signal (TLS2) in the Kex2p C-tail. TLS2 delayed exit of Kex2p from the TGN, whereas TLS1 did not affect this step. We propose that Soi1p promotes cycling of TGN membrane proteins between the TGN and PVC by antagonizing a TGN retention signal (TLS2) and facilitating the function of a retrieval signal (TLS1) that acts at the PVC.

Show MeSH
Related in: MedlinePlus