Limits...
pEg7, a new Xenopus protein required for mitotic chromosome condensation in egg extracts.

Cubizolles F, Legagneux V, Le Guellec R, Chartrain I, Uzbekov R, Ford C, Le Guellec K - J. Cell Biol. (1998)

Bottom Line: This maternal mRNA encodes a protein, pEg7, whose expression is strongly increased during oocyte maturation.A similar localization of pEg7 is observed when sperm chromatin is allowed to form mitotic chromosomes in cytostatic factor-arrested egg extracts.Biochemical experiments show that pEg7 associates with Xenopus chromosome-associated polypeptides C and E, two components of the 13S condensin.

View Article: PubMed Central - PubMed

Affiliation: Biologie et Génétique du Développement, CNRS UPR 41, Université de Rennes I, Campus de Beaulieu, 35042 Rennes cedex, France.

ABSTRACT
We have isolated a cDNA, Eg7, corresponding to a Xenopus maternal mRNA, which is polyadenylated in mature oocytes and deadenylated in early embryos. This maternal mRNA encodes a protein, pEg7, whose expression is strongly increased during oocyte maturation. The tissue and cell expression pattern of pEg7 indicates that this protein is only readily detected in cultured cells and germ cells. Immunolocalization in Xenopus cultured cells indicates that pEg7 concentrates onto chromosomes during mitosis. A similar localization of pEg7 is observed when sperm chromatin is allowed to form mitotic chromosomes in cytostatic factor-arrested egg extracts. Incubating these extracts with antibodies directed against two distinct parts of pEg7 provokes a strong inhibition of the condensation and resolution of mitotic chromosomes. Biochemical experiments show that pEg7 associates with Xenopus chromosome-associated polypeptides C and E, two components of the 13S condensin.

Show MeSH

Related in: MedlinePlus

Cloning of Eg7 cDNA.  (A) The open box represents the  coding region (1,360 amino acids). Eg7.1–Eg7.4 correspond to  partial cDNAs obtained by  screening a Xenopus egg library.  Eg7.5 and Eg7.6 were obtained by  PCR from an oocyte library. The  positions of primers used for  nested PCRs are indicated by arrows. (B) Comparison of the deduced amino-acid sequences of  Xenopus pEg7 (Xl-Eg7) and the  human gene product KIAA0159  (Hs-ORF). The P (amino acids  489–710) and G (amino acids  720–960) regions used to construct the His-tagged recombinant polypeptides are delimited  by arrows above the Xl–Eg7 sequence.
© Copyright Policy
Related In: Results  -  Collection


getmorefigures.php?uid=PMC2132990&req=5

Figure 1: Cloning of Eg7 cDNA. (A) The open box represents the coding region (1,360 amino acids). Eg7.1–Eg7.4 correspond to partial cDNAs obtained by screening a Xenopus egg library. Eg7.5 and Eg7.6 were obtained by PCR from an oocyte library. The positions of primers used for nested PCRs are indicated by arrows. (B) Comparison of the deduced amino-acid sequences of Xenopus pEg7 (Xl-Eg7) and the human gene product KIAA0159 (Hs-ORF). The P (amino acids 489–710) and G (amino acids 720–960) regions used to construct the His-tagged recombinant polypeptides are delimited by arrows above the Xl–Eg7 sequence.

Mentions: A partial Eg7 cDNA was isolated by differential screening of an unfertilized Xenopus egg λgt10 cDNA library as already described (Paris and Philippe, 1990). Four overlapping clones (Eg7.1–Eg7.4) were isolated from the same library by using the partial cDNA as a probe. The NH2-terminal region of Eg7 cDNA was recovered with two nested PCR (see Fig. 1 A). The first nested PCR was performed on the same library using a vector forward primer and an Eg7 outer primer (5′CTTCGGTTTCAATATCCTCC3′, OP1). The PCR product was reamplified using the same vector forward primer and Eg7 inner primer (5′CCGAATTCTAACATGGCTCCC3′, IP1). This PCR product (Eg7.5) was digested by EcoRI and subcloned into the EcoRI site of pBluescript KS (Stratagene Inc.). The second PCR was performed with a Xenopus ovary Unizap cDNA library (Stratagene Inc.) using the vector reverse primer and an Eg7 outer primer (5′ACTGCATTCCTCATC3′, OP2). This PCR product was reamplified with the vector SK primer and an Eg7 inner primer (5′GGGGAATTCCTCCACCACAGACATG3′, IP2). The PCR product (Eg7.6) was digested with EcoRI and subcloned into the EcoRI site of pBluescript. Sequences were determined on both strands according to the method of Sanger et al. (1977). Searches in databases and sequence comparisons were performed with BLAST and FASTA programs (Pearson and Lipman, 1988).


pEg7, a new Xenopus protein required for mitotic chromosome condensation in egg extracts.

Cubizolles F, Legagneux V, Le Guellec R, Chartrain I, Uzbekov R, Ford C, Le Guellec K - J. Cell Biol. (1998)

Cloning of Eg7 cDNA.  (A) The open box represents the  coding region (1,360 amino acids). Eg7.1–Eg7.4 correspond to  partial cDNAs obtained by  screening a Xenopus egg library.  Eg7.5 and Eg7.6 were obtained by  PCR from an oocyte library. The  positions of primers used for  nested PCRs are indicated by arrows. (B) Comparison of the deduced amino-acid sequences of  Xenopus pEg7 (Xl-Eg7) and the  human gene product KIAA0159  (Hs-ORF). The P (amino acids  489–710) and G (amino acids  720–960) regions used to construct the His-tagged recombinant polypeptides are delimited  by arrows above the Xl–Eg7 sequence.
© Copyright Policy
Related In: Results  -  Collection

Show All Figures
getmorefigures.php?uid=PMC2132990&req=5

Figure 1: Cloning of Eg7 cDNA. (A) The open box represents the coding region (1,360 amino acids). Eg7.1–Eg7.4 correspond to partial cDNAs obtained by screening a Xenopus egg library. Eg7.5 and Eg7.6 were obtained by PCR from an oocyte library. The positions of primers used for nested PCRs are indicated by arrows. (B) Comparison of the deduced amino-acid sequences of Xenopus pEg7 (Xl-Eg7) and the human gene product KIAA0159 (Hs-ORF). The P (amino acids 489–710) and G (amino acids 720–960) regions used to construct the His-tagged recombinant polypeptides are delimited by arrows above the Xl–Eg7 sequence.
Mentions: A partial Eg7 cDNA was isolated by differential screening of an unfertilized Xenopus egg λgt10 cDNA library as already described (Paris and Philippe, 1990). Four overlapping clones (Eg7.1–Eg7.4) were isolated from the same library by using the partial cDNA as a probe. The NH2-terminal region of Eg7 cDNA was recovered with two nested PCR (see Fig. 1 A). The first nested PCR was performed on the same library using a vector forward primer and an Eg7 outer primer (5′CTTCGGTTTCAATATCCTCC3′, OP1). The PCR product was reamplified using the same vector forward primer and Eg7 inner primer (5′CCGAATTCTAACATGGCTCCC3′, IP1). This PCR product (Eg7.5) was digested by EcoRI and subcloned into the EcoRI site of pBluescript KS (Stratagene Inc.). The second PCR was performed with a Xenopus ovary Unizap cDNA library (Stratagene Inc.) using the vector reverse primer and an Eg7 outer primer (5′ACTGCATTCCTCATC3′, OP2). This PCR product was reamplified with the vector SK primer and an Eg7 inner primer (5′GGGGAATTCCTCCACCACAGACATG3′, IP2). The PCR product (Eg7.6) was digested with EcoRI and subcloned into the EcoRI site of pBluescript. Sequences were determined on both strands according to the method of Sanger et al. (1977). Searches in databases and sequence comparisons were performed with BLAST and FASTA programs (Pearson and Lipman, 1988).

Bottom Line: This maternal mRNA encodes a protein, pEg7, whose expression is strongly increased during oocyte maturation.A similar localization of pEg7 is observed when sperm chromatin is allowed to form mitotic chromosomes in cytostatic factor-arrested egg extracts.Biochemical experiments show that pEg7 associates with Xenopus chromosome-associated polypeptides C and E, two components of the 13S condensin.

View Article: PubMed Central - PubMed

Affiliation: Biologie et Génétique du Développement, CNRS UPR 41, Université de Rennes I, Campus de Beaulieu, 35042 Rennes cedex, France.

ABSTRACT
We have isolated a cDNA, Eg7, corresponding to a Xenopus maternal mRNA, which is polyadenylated in mature oocytes and deadenylated in early embryos. This maternal mRNA encodes a protein, pEg7, whose expression is strongly increased during oocyte maturation. The tissue and cell expression pattern of pEg7 indicates that this protein is only readily detected in cultured cells and germ cells. Immunolocalization in Xenopus cultured cells indicates that pEg7 concentrates onto chromosomes during mitosis. A similar localization of pEg7 is observed when sperm chromatin is allowed to form mitotic chromosomes in cytostatic factor-arrested egg extracts. Incubating these extracts with antibodies directed against two distinct parts of pEg7 provokes a strong inhibition of the condensation and resolution of mitotic chromosomes. Biochemical experiments show that pEg7 associates with Xenopus chromosome-associated polypeptides C and E, two components of the 13S condensin.

Show MeSH
Related in: MedlinePlus