Limits...
Design and synthesis of boronic-acid-labeled thymidine triphosphate for incorporation into DNA.

Lin N, Yan J, Huang Z, Altier C, Li M, Carrasco N, Suyemoto M, Johnston L, Wang S, Wang Q, Fang H, Caton-Williams J, Wang B - Nucleic Acids Res. (2007)

Bottom Line: We have successfully synthesized a boronic acid-labeled thymidine triphosphate (B-TTP) linked through a 14-atom tether and effectively incorporated it into DNA by enzymatic polymerization.We have demonstrated that DNA polymerase can effectively recognize the boronic acid-labeled DNA as the template for DNA polymerization, that allows PCR amplification of boronic acid-labeled DNA.DNA polymerase recognitions of the B-TTP as a substrate and the boronic acid-labeled DNA as a template are critical issues for the development of DNA-based lectin mimics via in vitro selection.

View Article: PubMed Central - PubMed

Affiliation: Department of Chemistry and Center for Biotechnology and Drug Design, Campus Box 4098, Georgia State University, Atlanta, GA 30302-4098, USA.

ABSTRACT
The boronic acid moiety is a versatile functional group useful in carbohydrate recognition, glycoprotein pull-down, inhibition of hydrolytic enzymes and boron neutron capture therapy. The incorporation of the boronic-acid group into DNA could lead to molecules of various biological functions. We have successfully synthesized a boronic acid-labeled thymidine triphosphate (B-TTP) linked through a 14-atom tether and effectively incorporated it into DNA by enzymatic polymerization. The synthesis was achieved using the Huisgen cycloaddition as the key reaction. We have demonstrated that DNA polymerase can effectively recognize the boronic acid-labeled DNA as the template for DNA polymerization, that allows PCR amplification of boronic acid-labeled DNA. DNA polymerase recognitions of the B-TTP as a substrate and the boronic acid-labeled DNA as a template are critical issues for the development of DNA-based lectin mimics via in vitro selection.

Show MeSH
Primer extension using the full-length DNA and boronic acid-labeled DNA as templates. Reaction was performed with 5 µM primer 1/template, 0.4 mM of each dNTPs, 0.4 mM of labeled-TTP (M-TTP and B-TTP), and Klenow 0.04 units for 1 h. After centrifugation–filtration, the reaction was performed with radio-labeled 5′-32P-primer 2 and 0.4 mM of each dNTPs. Co-spot 1: polymerization using M-TTP and TTP-derived DNA as templates, Co-spot 2: polymerization using B-TTP and TTP-derived DNA as templates. Primer 1: 5′-GCGTAATACGACTCACTATA-3′; Template DNA: 3′CGCATTATGCTGAGTGATATCCGTTGGACTACTCCGGCTT TCCGGCTTTGCATGT-5′; Primer 2: 5′-TGTACGTTTCGGCCTTTCGG-3′.
© Copyright Policy - openaccess
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC1851626&req=5

Figure 4: Primer extension using the full-length DNA and boronic acid-labeled DNA as templates. Reaction was performed with 5 µM primer 1/template, 0.4 mM of each dNTPs, 0.4 mM of labeled-TTP (M-TTP and B-TTP), and Klenow 0.04 units for 1 h. After centrifugation–filtration, the reaction was performed with radio-labeled 5′-32P-primer 2 and 0.4 mM of each dNTPs. Co-spot 1: polymerization using M-TTP and TTP-derived DNA as templates, Co-spot 2: polymerization using B-TTP and TTP-derived DNA as templates. Primer 1: 5′-GCGTAATACGACTCACTATA-3′; Template DNA: 3′CGCATTATGCTGAGTGATATCCGTTGGACTACTCCGGCTT TCCGGCTTTGCATGT-5′; Primer 2: 5′-TGTACGTTTCGGCCTTTCGG-3′.

Mentions: To demonstrate the recognition of boronic acid-labeled full-length DNA as templates by the Klenow fragment, two 20-nt primers for the 5′- and 3′-ends, respectively, were synthesized (Figure 4). The polymerase reactions using the boronic acid-labeled DNA as the template and with M-TTP (11), TTP or B-TTP (12) and the other three dNTPs as the monomers were carried out first with primer 1, which is complementary to the 3′-terminus of the full-length DNA. After primer extension, the full-length DNA obtained was purified by membrane filtration to remove the labeled and non-labeled dNTPs. Then further polymerization was conducted using natural dNTPs and 5′-32P-labeled primer 2, which is complementary to the 3′-terminus of the polymerized full-length DNA templates. Gel electrophoresis of the DNA products shows no noticeable differences between the experiments using natural and labeled full-length DNA as templates, indicating that all full-length DNA templates generated using M-TTP, TTP and B-TTP in the first primer extension were recognized with a similar efficiency by the polymerase (Figure 4). Such results are very critical for future work.Figure 4.


Design and synthesis of boronic-acid-labeled thymidine triphosphate for incorporation into DNA.

Lin N, Yan J, Huang Z, Altier C, Li M, Carrasco N, Suyemoto M, Johnston L, Wang S, Wang Q, Fang H, Caton-Williams J, Wang B - Nucleic Acids Res. (2007)

Primer extension using the full-length DNA and boronic acid-labeled DNA as templates. Reaction was performed with 5 µM primer 1/template, 0.4 mM of each dNTPs, 0.4 mM of labeled-TTP (M-TTP and B-TTP), and Klenow 0.04 units for 1 h. After centrifugation–filtration, the reaction was performed with radio-labeled 5′-32P-primer 2 and 0.4 mM of each dNTPs. Co-spot 1: polymerization using M-TTP and TTP-derived DNA as templates, Co-spot 2: polymerization using B-TTP and TTP-derived DNA as templates. Primer 1: 5′-GCGTAATACGACTCACTATA-3′; Template DNA: 3′CGCATTATGCTGAGTGATATCCGTTGGACTACTCCGGCTT TCCGGCTTTGCATGT-5′; Primer 2: 5′-TGTACGTTTCGGCCTTTCGG-3′.
© Copyright Policy - openaccess
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC1851626&req=5

Figure 4: Primer extension using the full-length DNA and boronic acid-labeled DNA as templates. Reaction was performed with 5 µM primer 1/template, 0.4 mM of each dNTPs, 0.4 mM of labeled-TTP (M-TTP and B-TTP), and Klenow 0.04 units for 1 h. After centrifugation–filtration, the reaction was performed with radio-labeled 5′-32P-primer 2 and 0.4 mM of each dNTPs. Co-spot 1: polymerization using M-TTP and TTP-derived DNA as templates, Co-spot 2: polymerization using B-TTP and TTP-derived DNA as templates. Primer 1: 5′-GCGTAATACGACTCACTATA-3′; Template DNA: 3′CGCATTATGCTGAGTGATATCCGTTGGACTACTCCGGCTT TCCGGCTTTGCATGT-5′; Primer 2: 5′-TGTACGTTTCGGCCTTTCGG-3′.
Mentions: To demonstrate the recognition of boronic acid-labeled full-length DNA as templates by the Klenow fragment, two 20-nt primers for the 5′- and 3′-ends, respectively, were synthesized (Figure 4). The polymerase reactions using the boronic acid-labeled DNA as the template and with M-TTP (11), TTP or B-TTP (12) and the other three dNTPs as the monomers were carried out first with primer 1, which is complementary to the 3′-terminus of the full-length DNA. After primer extension, the full-length DNA obtained was purified by membrane filtration to remove the labeled and non-labeled dNTPs. Then further polymerization was conducted using natural dNTPs and 5′-32P-labeled primer 2, which is complementary to the 3′-terminus of the polymerized full-length DNA templates. Gel electrophoresis of the DNA products shows no noticeable differences between the experiments using natural and labeled full-length DNA as templates, indicating that all full-length DNA templates generated using M-TTP, TTP and B-TTP in the first primer extension were recognized with a similar efficiency by the polymerase (Figure 4). Such results are very critical for future work.Figure 4.

Bottom Line: We have successfully synthesized a boronic acid-labeled thymidine triphosphate (B-TTP) linked through a 14-atom tether and effectively incorporated it into DNA by enzymatic polymerization.We have demonstrated that DNA polymerase can effectively recognize the boronic acid-labeled DNA as the template for DNA polymerization, that allows PCR amplification of boronic acid-labeled DNA.DNA polymerase recognitions of the B-TTP as a substrate and the boronic acid-labeled DNA as a template are critical issues for the development of DNA-based lectin mimics via in vitro selection.

View Article: PubMed Central - PubMed

Affiliation: Department of Chemistry and Center for Biotechnology and Drug Design, Campus Box 4098, Georgia State University, Atlanta, GA 30302-4098, USA.

ABSTRACT
The boronic acid moiety is a versatile functional group useful in carbohydrate recognition, glycoprotein pull-down, inhibition of hydrolytic enzymes and boron neutron capture therapy. The incorporation of the boronic-acid group into DNA could lead to molecules of various biological functions. We have successfully synthesized a boronic acid-labeled thymidine triphosphate (B-TTP) linked through a 14-atom tether and effectively incorporated it into DNA by enzymatic polymerization. The synthesis was achieved using the Huisgen cycloaddition as the key reaction. We have demonstrated that DNA polymerase can effectively recognize the boronic acid-labeled DNA as the template for DNA polymerization, that allows PCR amplification of boronic acid-labeled DNA. DNA polymerase recognitions of the B-TTP as a substrate and the boronic acid-labeled DNA as a template are critical issues for the development of DNA-based lectin mimics via in vitro selection.

Show MeSH