Limits...
Global analysis of yeast RNA processing identifies new targets of RNase III and uncovers a link between tRNA 5' end processing and tRNA splicing.

Hiley SL, Babak T, Hughes TR - Nucleic Acids Res. (2005)

Bottom Line: We also monitored the accumulation of improperly processed flank sequences of pre-RNAs in strains depleted for known RNA nucleases, including RNase III, Dbr1p, Xrn1p, Rat1p and components of the exosome and RNase P complexes.Among the hundreds of aberrant RNA processing events detected, two novel substrates of Rnt1p (the RUF1 and RUF3 snoRNAs) were identified.We also identified a relationship between tRNA 5' end processing and tRNA splicing, processes that were previously thought to be independent.

View Article: PubMed Central - PubMed

Affiliation: Banting and Best Department of Medical Research, University of Toronto 112 College Street, Toronto, ON M5G 1L6, Canada.

ABSTRACT
We used a microarray containing probes that tile all known yeast noncoding RNAs (ncRNAs) to investigate RNA biogenesis on a global scale. The microarray verified a general loss of Box C/D snoRNAs in the TetO7-BCD1 mutant, which had previously been shown for only a handful of snoRNAs. We also monitored the accumulation of improperly processed flank sequences of pre-RNAs in strains depleted for known RNA nucleases, including RNase III, Dbr1p, Xrn1p, Rat1p and components of the exosome and RNase P complexes. Among the hundreds of aberrant RNA processing events detected, two novel substrates of Rnt1p (the RUF1 and RUF3 snoRNAs) were identified. We also identified a relationship between tRNA 5' end processing and tRNA splicing, processes that were previously thought to be independent. This analysis demonstrates the applicability of microarray technology to the study of global analysis of ncRNA synthesis and provides an extensive directory of processing events mediated by yeast ncRNA processing enzymes.

Show MeSH

Related in: MedlinePlus

Microarray analysis reveals a partial dependence of tRNA splicing on tRNA 5′ end processing. (A) Relative fluorescence of probes complementary to select tRNAs are shown with schematic diagrams below. (B) Relative fluorescence of LeuCAA tRNA probes is shown for the nine microarray experiments shown in Figure 2A. (C) Northern blot analysis of LeuCAA tRNA species present in TetO7-POP1 and POP4 strains is shown. The same blot was probed sequentially with three different probes, as indicated by the schematic diagrams at the top of each blot (with the red line indicating the position of the probe). The identity of each tRNA species is shown to the right.
© Copyright Policy
Related In: Results  -  Collection


getmorefigures.php?uid=PMC1140755&req=5

fig4: Microarray analysis reveals a partial dependence of tRNA splicing on tRNA 5′ end processing. (A) Relative fluorescence of probes complementary to select tRNAs are shown with schematic diagrams below. (B) Relative fluorescence of LeuCAA tRNA probes is shown for the nine microarray experiments shown in Figure 2A. (C) Northern blot analysis of LeuCAA tRNA species present in TetO7-POP1 and POP4 strains is shown. The same blot was probed sequentially with three different probes, as indicated by the schematic diagrams at the top of each blot (with the red line indicating the position of the probe). The identity of each tRNA species is shown to the right.

Mentions: For northern blot analysis, 5 μg of total RNA from each strain (isolated and treated with DNase I as described above) was separated on 10% denaturing polyacrylamide–urea gels and transferred to a Hybond-XL membrane (Amersham) in 0.5× TBE using a semi-dry transfer apparatus (Bio-Rad). Membranes were UV-crosslinked and hybridized in Church buffer using 5′-32P-end-labeled complementary oligonucleotide probes as indicated in the figures. Images were visualized using a PhosphorImager (Bio-Rad Personal FX). Probe sequences were as follows (5′ to 3′): (Figure 3B) RUF3 5′flank, CACACGTACTAGACTTTATCTGTCTTGATTG; RUF3 body, CAATTGTTGTAGTCGCAACTACGGTAATTG; RUF1 5′ flank, GTACTCTCATTAACTAGCTCTGTTATTC; RUF1 body, AAAAAGTCGCAACCTCAATCATGCCTTTTCTC; (Figure 4C) tRNA LeuCAA 5′ flank, GGCCAAACAACCACTTATTTGTATGTTTCG; tRNA LeuCAA intron, TATTCCCACAGTTAACTGCGGTCAAGATATTG; tRNA LeuCAA exon 1, CTTGAATCAGGCGCCTTAGACCGCTC.


Global analysis of yeast RNA processing identifies new targets of RNase III and uncovers a link between tRNA 5' end processing and tRNA splicing.

Hiley SL, Babak T, Hughes TR - Nucleic Acids Res. (2005)

Microarray analysis reveals a partial dependence of tRNA splicing on tRNA 5′ end processing. (A) Relative fluorescence of probes complementary to select tRNAs are shown with schematic diagrams below. (B) Relative fluorescence of LeuCAA tRNA probes is shown for the nine microarray experiments shown in Figure 2A. (C) Northern blot analysis of LeuCAA tRNA species present in TetO7-POP1 and POP4 strains is shown. The same blot was probed sequentially with three different probes, as indicated by the schematic diagrams at the top of each blot (with the red line indicating the position of the probe). The identity of each tRNA species is shown to the right.
© Copyright Policy
Related In: Results  -  Collection

Show All Figures
getmorefigures.php?uid=PMC1140755&req=5

fig4: Microarray analysis reveals a partial dependence of tRNA splicing on tRNA 5′ end processing. (A) Relative fluorescence of probes complementary to select tRNAs are shown with schematic diagrams below. (B) Relative fluorescence of LeuCAA tRNA probes is shown for the nine microarray experiments shown in Figure 2A. (C) Northern blot analysis of LeuCAA tRNA species present in TetO7-POP1 and POP4 strains is shown. The same blot was probed sequentially with three different probes, as indicated by the schematic diagrams at the top of each blot (with the red line indicating the position of the probe). The identity of each tRNA species is shown to the right.
Mentions: For northern blot analysis, 5 μg of total RNA from each strain (isolated and treated with DNase I as described above) was separated on 10% denaturing polyacrylamide–urea gels and transferred to a Hybond-XL membrane (Amersham) in 0.5× TBE using a semi-dry transfer apparatus (Bio-Rad). Membranes were UV-crosslinked and hybridized in Church buffer using 5′-32P-end-labeled complementary oligonucleotide probes as indicated in the figures. Images were visualized using a PhosphorImager (Bio-Rad Personal FX). Probe sequences were as follows (5′ to 3′): (Figure 3B) RUF3 5′flank, CACACGTACTAGACTTTATCTGTCTTGATTG; RUF3 body, CAATTGTTGTAGTCGCAACTACGGTAATTG; RUF1 5′ flank, GTACTCTCATTAACTAGCTCTGTTATTC; RUF1 body, AAAAAGTCGCAACCTCAATCATGCCTTTTCTC; (Figure 4C) tRNA LeuCAA 5′ flank, GGCCAAACAACCACTTATTTGTATGTTTCG; tRNA LeuCAA intron, TATTCCCACAGTTAACTGCGGTCAAGATATTG; tRNA LeuCAA exon 1, CTTGAATCAGGCGCCTTAGACCGCTC.

Bottom Line: We also monitored the accumulation of improperly processed flank sequences of pre-RNAs in strains depleted for known RNA nucleases, including RNase III, Dbr1p, Xrn1p, Rat1p and components of the exosome and RNase P complexes.Among the hundreds of aberrant RNA processing events detected, two novel substrates of Rnt1p (the RUF1 and RUF3 snoRNAs) were identified.We also identified a relationship between tRNA 5' end processing and tRNA splicing, processes that were previously thought to be independent.

View Article: PubMed Central - PubMed

Affiliation: Banting and Best Department of Medical Research, University of Toronto 112 College Street, Toronto, ON M5G 1L6, Canada.

ABSTRACT
We used a microarray containing probes that tile all known yeast noncoding RNAs (ncRNAs) to investigate RNA biogenesis on a global scale. The microarray verified a general loss of Box C/D snoRNAs in the TetO7-BCD1 mutant, which had previously been shown for only a handful of snoRNAs. We also monitored the accumulation of improperly processed flank sequences of pre-RNAs in strains depleted for known RNA nucleases, including RNase III, Dbr1p, Xrn1p, Rat1p and components of the exosome and RNase P complexes. Among the hundreds of aberrant RNA processing events detected, two novel substrates of Rnt1p (the RUF1 and RUF3 snoRNAs) were identified. We also identified a relationship between tRNA 5' end processing and tRNA splicing, processes that were previously thought to be independent. This analysis demonstrates the applicability of microarray technology to the study of global analysis of ncRNA synthesis and provides an extensive directory of processing events mediated by yeast ncRNA processing enzymes.

Show MeSH
Related in: MedlinePlus